Incidental Mutation 'R6965:Thap12'
ID 541945
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms 2900052B10Rik, Dap4, Prkrir
MMRRC Submission 045075-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R6965 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98352310-98367269 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98364669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 279 (V279D)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect probably damaging
Transcript: ENSMUST00000033009
AA Change: V279D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: V279D

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 119,882,452 (GRCm39) Q1205* probably null Het
Als2 A G 1: 59,209,716 (GRCm39) F1422S possibly damaging Het
Anapc4 T C 5: 52,993,093 (GRCm39) V68A possibly damaging Het
Atmin T C 8: 117,683,777 (GRCm39) F479S probably damaging Het
Atp7b T C 8: 22,518,101 (GRCm39) T234A probably benign Het
Bpifa1 G A 2: 153,987,581 (GRCm39) G144S probably damaging Het
Brf2 A T 8: 27,614,586 (GRCm39) M200K probably benign Het
C1ql2 G A 1: 120,268,944 (GRCm39) C33Y probably damaging Het
Cdk18 A G 1: 132,045,319 (GRCm39) V269A probably damaging Het
Clcc1 T C 3: 108,580,625 (GRCm39) V313A probably damaging Het
Cntrl A T 2: 35,052,845 (GRCm39) T1117S probably benign Het
Col15a1 G A 4: 47,247,533 (GRCm39) E236K probably damaging Het
Comp T C 8: 70,829,164 (GRCm39) L278P probably damaging Het
Csnk2a1-ps3 C T 1: 156,352,119 (GRCm39) R107* probably null Het
Dlg5 C A 14: 24,199,498 (GRCm39) D1469Y probably damaging Het
Efna1 A T 3: 89,186,782 (GRCm39) V23D probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epb41l4b T C 4: 57,040,915 (GRCm39) Y516C probably damaging Het
Esr2 T C 12: 76,168,631 (GRCm39) D526G probably damaging Het
Fam184b T C 5: 45,712,477 (GRCm39) T514A probably benign Het
Fcmr A C 1: 130,803,724 (GRCm39) E176A possibly damaging Het
Fry T A 5: 150,339,685 (GRCm39) N1485K possibly damaging Het
Fut2 A G 7: 45,300,305 (GRCm39) C156R probably damaging Het
Gm5431 T C 11: 48,786,027 (GRCm39) Y116C probably benign Het
Gm5493 T A 17: 22,967,047 (GRCm39) V61E possibly damaging Het
Golga4 A T 9: 118,377,847 (GRCm39) Q456L probably damaging Het
Gpam T C 19: 55,063,041 (GRCm39) Y757C probably damaging Het
Iqcg C T 16: 32,851,174 (GRCm39) A266T probably benign Het
Lta4h G T 10: 93,307,759 (GRCm39) G331* probably null Het
Macf1 C A 4: 123,302,538 (GRCm39) V655F probably benign Het
Map3k13 T A 16: 21,740,900 (GRCm39) D742E probably benign Het
Mrgprb2 G A 7: 48,202,597 (GRCm39) L43F probably damaging Het
N4bp1 T C 8: 87,571,461 (GRCm39) R846G probably damaging Het
Nbn T C 4: 15,970,863 (GRCm39) I282T probably benign Het
Ncor1 C T 11: 62,244,059 (GRCm39) probably null Het
Or4a77 G T 2: 89,487,009 (GRCm39) P259T probably damaging Het
Or4d10c A G 19: 12,066,120 (GRCm39) F12S possibly damaging Het
Or8b12 T A 9: 37,657,433 (GRCm39) M1K probably null Het
Pclo A G 5: 14,731,976 (GRCm39) probably benign Het
Pde9a G T 17: 31,662,861 (GRCm39) V97L probably benign Het
Ptch1 T C 13: 63,672,881 (GRCm39) Y771C possibly damaging Het
R3hcc1l G A 19: 42,551,284 (GRCm39) D94N probably damaging Het
Rnpep T A 1: 135,190,858 (GRCm39) K602* probably null Het
Rph3al T C 11: 75,745,276 (GRCm39) Y156C probably damaging Het
Rundc1 A T 11: 101,324,737 (GRCm39) Y481F possibly damaging Het
Serpinb9f A G 13: 33,509,859 (GRCm39) K17R possibly damaging Het
Smpd3 T C 8: 106,986,513 (GRCm39) H459R probably damaging Het
Spata31 A C 13: 65,070,648 (GRCm39) Q932P possibly damaging Het
Srgap3 C T 6: 112,700,090 (GRCm39) A963T probably damaging Het
Syne1 A T 10: 5,179,120 (GRCm39) F4451L possibly damaging Het
Tbc1d19 T A 5: 54,014,266 (GRCm39) probably null Het
Tmprss6 T C 15: 78,328,328 (GRCm39) D544G probably damaging Het
Tox2 A G 2: 163,164,930 (GRCm39) *523W probably null Het
Txnrd1 T C 10: 82,717,652 (GRCm39) I212T probably benign Het
Unc80 T C 1: 66,685,725 (GRCm39) I2283T probably benign Het
Vmn1r176 A G 7: 23,535,099 (GRCm39) I18T possibly damaging Het
Vmn2r101 C T 17: 19,811,284 (GRCm39) T456I probably benign Het
Vmn2r79 T A 7: 86,651,100 (GRCm39) H166Q probably benign Het
Zer1 A G 2: 29,991,059 (GRCm39) V723A possibly damaging Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98,365,344 (GRCm39) missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98,362,110 (GRCm39) makesense probably null
IGL01973:Thap12 APN 7 98,365,706 (GRCm39) missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98,359,340 (GRCm39) missense probably damaging 1.00
H8562:Thap12 UTSW 7 98,364,314 (GRCm39) missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98,364,245 (GRCm39) missense probably benign 0.00
R0090:Thap12 UTSW 7 98,365,100 (GRCm39) missense probably damaging 1.00
R0254:Thap12 UTSW 7 98,364,488 (GRCm39) missense probably benign 0.03
R1344:Thap12 UTSW 7 98,366,037 (GRCm39) missense probably damaging 0.97
R1384:Thap12 UTSW 7 98,352,645 (GRCm39) missense probably damaging 0.98
R1418:Thap12 UTSW 7 98,366,037 (GRCm39) missense probably damaging 0.97
R1448:Thap12 UTSW 7 98,365,230 (GRCm39) missense probably benign 0.01
R1493:Thap12 UTSW 7 98,364,645 (GRCm39) missense probably benign 0.30
R1906:Thap12 UTSW 7 98,365,947 (GRCm39) missense probably damaging 1.00
R1932:Thap12 UTSW 7 98,366,045 (GRCm39) missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98,365,572 (GRCm39) missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98,365,827 (GRCm39) missense probably damaging 1.00
R2092:Thap12 UTSW 7 98,365,656 (GRCm39) missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98,359,333 (GRCm39) missense probably damaging 0.97
R3850:Thap12 UTSW 7 98,365,870 (GRCm39) missense probably damaging 1.00
R4086:Thap12 UTSW 7 98,365,701 (GRCm39) missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98,359,285 (GRCm39) intron probably benign
R4554:Thap12 UTSW 7 98,365,052 (GRCm39) missense probably benign 0.00
R4555:Thap12 UTSW 7 98,365,052 (GRCm39) missense probably benign 0.00
R4556:Thap12 UTSW 7 98,365,052 (GRCm39) missense probably benign 0.00
R4557:Thap12 UTSW 7 98,365,052 (GRCm39) missense probably benign 0.00
R4659:Thap12 UTSW 7 98,359,298 (GRCm39) intron probably benign
R4734:Thap12 UTSW 7 98,365,162 (GRCm39) nonsense probably null
R4734:Thap12 UTSW 7 98,365,161 (GRCm39) missense probably damaging 0.98
R5794:Thap12 UTSW 7 98,365,600 (GRCm39) missense probably benign 0.11
R5994:Thap12 UTSW 7 98,365,237 (GRCm39) nonsense probably null
R6298:Thap12 UTSW 7 98,352,612 (GRCm39) missense probably damaging 1.00
R6515:Thap12 UTSW 7 98,356,302 (GRCm39) missense probably damaging 0.97
R6624:Thap12 UTSW 7 98,364,793 (GRCm39) nonsense probably null
R6625:Thap12 UTSW 7 98,365,277 (GRCm39) missense probably benign 0.00
R7560:Thap12 UTSW 7 98,359,438 (GRCm39) missense probably damaging 0.99
R8182:Thap12 UTSW 7 98,365,584 (GRCm39) missense probably damaging 1.00
R8713:Thap12 UTSW 7 98,356,283 (GRCm39) missense probably benign 0.30
R8897:Thap12 UTSW 7 98,364,534 (GRCm39) missense probably benign 0.38
R9099:Thap12 UTSW 7 98,364,600 (GRCm39) missense probably damaging 1.00
R9260:Thap12 UTSW 7 98,356,280 (GRCm39) nonsense probably null
R9339:Thap12 UTSW 7 98,364,323 (GRCm39) missense possibly damaging 0.95
R9467:Thap12 UTSW 7 98,359,348 (GRCm39) missense probably damaging 0.99
R9644:Thap12 UTSW 7 98,364,495 (GRCm39) missense probably damaging 0.97
R9789:Thap12 UTSW 7 98,352,592 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCGGTCAACACATTATTCTGCTC -3'
(R):5'- ACAGACTTTGCCAACCATGC -3'

Sequencing Primer
(F):5'- TGCTCTAAAACTCAGCAGAGG -3'
(R):5'- TTGCCAACCATGCATTTAAGGC -3'
Posted On 2018-11-28