Incidental Mutation 'R6965:Smpd3'
ID541951
Institutional Source Beutler Lab
Gene Symbol Smpd3
Ensembl Gene ENSMUSG00000031906
Gene Namesphingomyelin phosphodiesterase 3, neutral
Synonymsneutral sphingomyelinase II, nSMase2, fro, 4631433G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R6965 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location106252548-106337988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106259881 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 459 (H459R)
Ref Sequence ENSEMBL: ENSMUSP00000148282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067512] [ENSMUST00000212896]
Predicted Effect probably damaging
Transcript: ENSMUST00000067512
AA Change: H459R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069255
Gene: ENSMUSG00000031906
AA Change: H459R

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Pfam:Exo_endo_phos 321 639 1.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212896
AA Change: H459R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit dwarfism, delayed sexual and gonad maturation, delayed ossification of the long bones, and reduced serum levels of thyroxine, triiodothyronine, cortisol, and insulin-like growth factor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,283,229 Q1205* probably null Het
Als2 A G 1: 59,170,557 F1422S possibly damaging Het
Anapc4 T C 5: 52,835,751 V68A possibly damaging Het
Atmin T C 8: 116,957,038 F479S probably damaging Het
Atp7b T C 8: 22,028,085 T234A probably benign Het
Bpifa1 G A 2: 154,145,661 G144S probably damaging Het
Brf2 A T 8: 27,124,558 M200K probably benign Het
C1ql2 G A 1: 120,341,215 C33Y probably damaging Het
Cdk18 A G 1: 132,117,581 V269A probably damaging Het
Clcc1 T C 3: 108,673,309 V313A probably damaging Het
Cntrl A T 2: 35,162,833 T1117S probably benign Het
Col15a1 G A 4: 47,247,533 E236K probably damaging Het
Comp T C 8: 70,376,514 L278P probably damaging Het
Dlg5 C A 14: 24,149,430 D1469Y probably damaging Het
Efna1 A T 3: 89,279,475 V23D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epb41l4b T C 4: 57,040,915 Y516C probably damaging Het
Esr2 T C 12: 76,121,857 D526G probably damaging Het
Fam184b T C 5: 45,555,135 T514A probably benign Het
Fcmr A C 1: 130,875,987 E176A possibly damaging Het
Fry T A 5: 150,416,220 N1485K possibly damaging Het
Fut2 A G 7: 45,650,881 C156R probably damaging Het
Gm10031 C T 1: 156,524,549 R107* probably null Het
Gm5431 T C 11: 48,895,200 Y116C probably benign Het
Gm5493 T A 17: 22,748,074 V61E possibly damaging Het
Golga4 A T 9: 118,548,779 Q456L probably damaging Het
Gpam T C 19: 55,074,609 Y757C probably damaging Het
Iqcg C T 16: 33,030,804 A266T probably benign Het
Lta4h G T 10: 93,471,897 G331* probably null Het
Macf1 C A 4: 123,408,745 V655F probably benign Het
Map3k13 T A 16: 21,922,150 D742E probably benign Het
Mrgprb2 G A 7: 48,552,849 L43F probably damaging Het
N4bp1 T C 8: 86,844,833 R846G probably damaging Het
Nbn T C 4: 15,970,863 I282T probably benign Het
Ncor1 C T 11: 62,353,233 probably null Het
Olfr1250 G T 2: 89,656,665 P259T probably damaging Het
Olfr1426 A G 19: 12,088,756 F12S possibly damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Pclo A G 5: 14,681,962 probably benign Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Ptch1 T C 13: 63,525,067 Y771C possibly damaging Het
R3hcc1l G A 19: 42,562,845 D94N probably damaging Het
Rnpep T A 1: 135,263,120 K602* probably null Het
Rph3al T C 11: 75,854,450 Y156C probably damaging Het
Rundc1 A T 11: 101,433,911 Y481F possibly damaging Het
Serpinb9f A G 13: 33,325,876 K17R possibly damaging Het
Spata31 A C 13: 64,922,834 Q932P possibly damaging Het
Srgap3 C T 6: 112,723,129 A963T probably damaging Het
Syne1 A T 10: 5,229,120 F4451L possibly damaging Het
Tbc1d19 T A 5: 53,856,924 probably null Het
Thap12 T A 7: 98,715,462 V279D probably damaging Het
Tmprss6 T C 15: 78,444,128 D544G probably damaging Het
Tox2 A G 2: 163,323,010 *523W probably null Het
Txnrd1 T C 10: 82,881,818 I212T probably benign Het
Unc80 T C 1: 66,646,566 I2283T probably benign Het
Vmn1r176 A G 7: 23,835,674 I18T possibly damaging Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Vmn2r79 T A 7: 87,001,892 H166Q probably benign Het
Zer1 A G 2: 30,101,047 V723A possibly damaging Het
Other mutations in Smpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03380:Smpd3 APN 8 106259659 missense probably benign 0.01
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0456:Smpd3 UTSW 8 106259656 missense probably benign
R0759:Smpd3 UTSW 8 106265228 missense probably benign 0.34
R0799:Smpd3 UTSW 8 106264789 missense possibly damaging 0.92
R1544:Smpd3 UTSW 8 106265567 missense possibly damaging 0.70
R1756:Smpd3 UTSW 8 106264971 missense probably benign
R2937:Smpd3 UTSW 8 106264820 missense probably damaging 1.00
R2939:Smpd3 UTSW 8 106257407 missense probably benign 0.00
R4614:Smpd3 UTSW 8 106259739 missense probably damaging 1.00
R5829:Smpd3 UTSW 8 106264880 missense probably benign 0.15
R6822:Smpd3 UTSW 8 106265964 start gained probably benign
R6891:Smpd3 UTSW 8 106264668 missense probably damaging 1.00
R6962:Smpd3 UTSW 8 106265219 missense probably benign 0.34
R7344:Smpd3 UTSW 8 106265193 missense probably damaging 1.00
R7394:Smpd3 UTSW 8 106265010 missense probably damaging 0.99
R7823:Smpd3 UTSW 8 106255622 missense probably benign
R7825:Smpd3 UTSW 8 106255622 missense probably benign
Z1177:Smpd3 UTSW 8 106264842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCGGAAATCAGCCAGCC -3'
(R):5'- GACTCTTCTAGAAGCAGAGCC -3'

Sequencing Primer
(F):5'- TCAGCCAGCCAGTCCTGAAG -3'
(R):5'- TGTCTCCACCTGGGCACTAG -3'
Posted On2018-11-28