Mutagenetix > Incidental Mutation

Incidental Mutation 'R6965:Golga4'

541954

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6965 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118548779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 456 (Q456L)

Ref Sequence

ENSEMBL: ENSMUSP00000148748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097] [ENSMUST00000212461]

AlphaFold

Q91VW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000084820
AA Change: Q484L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: Q484L

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212097
AA Change: Q456L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212461

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	C	T	7: 120,283,229	Q1205*	probably null	Het
Als2	A	G	1: 59,170,557	F1422S	possibly damaging	Het
Anapc4	T	C	5: 52,835,751	V68A	possibly damaging	Het
Atmin	T	C	8: 116,957,038	F479S	probably damaging	Het
Atp7b	T	C	8: 22,028,085	T234A	probably benign	Het
Bpifa1	G	A	2: 154,145,661	G144S	probably damaging	Het
Brf2	A	T	8: 27,124,558	M200K	probably benign	Het
C1ql2	G	A	1: 120,341,215	C33Y	probably damaging	Het
Cdk18	A	G	1: 132,117,581	V269A	probably damaging	Het
Clcc1	T	C	3: 108,673,309	V313A	probably damaging	Het
Cntrl	A	T	2: 35,162,833	T1117S	probably benign	Het
Col15a1	G	A	4: 47,247,533	E236K	probably damaging	Het
Comp	T	C	8: 70,376,514	L278P	probably damaging	Het
Dlg5	C	A	14: 24,149,430	D1469Y	probably damaging	Het
Efna1	A	T	3: 89,279,475	V23D	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epb41l4b	T	C	4: 57,040,915	Y516C	probably damaging	Het
Esr2	T	C	12: 76,121,857	D526G	probably damaging	Het
Fam184b	T	C	5: 45,555,135	T514A	probably benign	Het
Fcmr	A	C	1: 130,875,987	E176A	possibly damaging	Het
Fry	T	A	5: 150,416,220	N1485K	possibly damaging	Het
Fut2	A	G	7: 45,650,881	C156R	probably damaging	Het
Gm10031	C	T	1: 156,524,549	R107*	probably null	Het
Gm5431	T	C	11: 48,895,200	Y116C	probably benign	Het
Gm5493	T	A	17: 22,748,074	V61E	possibly damaging	Het
Gpam	T	C	19: 55,074,609	Y757C	probably damaging	Het
Iqcg	C	T	16: 33,030,804	A266T	probably benign	Het
Lta4h	G	T	10: 93,471,897	G331*	probably null	Het
Macf1	C	A	4: 123,408,745	V655F	probably benign	Het
Map3k13	T	A	16: 21,922,150	D742E	probably benign	Het
Mrgprb2	G	A	7: 48,552,849	L43F	probably damaging	Het
N4bp1	T	C	8: 86,844,833	R846G	probably damaging	Het
Nbn	T	C	4: 15,970,863	I282T	probably benign	Het
Ncor1	C	T	11: 62,353,233		probably null	Het
Olfr1250	G	T	2: 89,656,665	P259T	probably damaging	Het
Olfr1426	A	G	19: 12,088,756	F12S	possibly damaging	Het
Olfr874	T	A	9: 37,746,137	M1K	probably null	Het
Pclo	A	G	5: 14,681,962		probably benign	Het
Pde9a	G	T	17: 31,443,887	V97L	probably benign	Het
Ptch1	T	C	13: 63,525,067	Y771C	possibly damaging	Het
R3hcc1l	G	A	19: 42,562,845	D94N	probably damaging	Het
Rnpep	T	A	1: 135,263,120	K602*	probably null	Het
Rph3al	T	C	11: 75,854,450	Y156C	probably damaging	Het
Rundc1	A	T	11: 101,433,911	Y481F	possibly damaging	Het
Serpinb9f	A	G	13: 33,325,876	K17R	possibly damaging	Het
Smpd3	T	C	8: 106,259,881	H459R	probably damaging	Het
Spata31	A	C	13: 64,922,834	Q932P	possibly damaging	Het
Srgap3	C	T	6: 112,723,129	A963T	probably damaging	Het
Syne1	A	T	10: 5,229,120	F4451L	possibly damaging	Het
Tbc1d19	T	A	5: 53,856,924		probably null	Het
Thap12	T	A	7: 98,715,462	V279D	probably damaging	Het
Tmprss6	T	C	15: 78,444,128	D544G	probably damaging	Het
Tox2	A	G	2: 163,323,010	*523W	probably null	Het
Txnrd1	T	C	10: 82,881,818	I212T	probably benign	Het
Unc80	T	C	1: 66,646,566	I2283T	probably benign	Het
Vmn1r176	A	G	7: 23,835,674	I18T	possibly damaging	Het
Vmn2r101	C	T	17: 19,591,022	T456I	probably benign	Het
Vmn2r79	T	A	7: 87,001,892	H166Q	probably benign	Het
Zer1	A	G	2: 30,101,047	V723A	possibly damaging	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GGAGCTCCTGAGATACTTGTTTTC -3'
(R):5'- GCACTGAAGCAGGTAAGCAC -3'

Sequencing Primer
(F):5'- GCTCCTGAGATACTTGTTTTCTGCTC -3'
(R):5'- TCAGGTCAGCGAGCCAATG -3'

Posted On

2018-11-28