Incidental Mutation 'R6965:Esr2'
ID541962
Institutional Source Beutler Lab
Gene Symbol Esr2
Ensembl Gene ENSMUSG00000021055
Gene Nameestrogen receptor 2 (beta)
SynonymsERbeta, ER beta, Estrb, oestrogen receptor beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.669) question?
Stock #R6965 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location76120419-76177259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76121857 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 526 (D526G)
Ref Sequence ENSEMBL: ENSMUSP00000151463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076634] [ENSMUST00000101291] [ENSMUST00000110421] [ENSMUST00000133564] [ENSMUST00000218621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076634
AA Change: D508G

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075932
Gene: ENSMUSG00000021055
AA Change: D508G

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 4.2e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 488 5.99e-34 SMART
Blast:HOLI 489 519 7e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000101291
AA Change: D507G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098849
Gene: ENSMUSG00000021055
AA Change: D507G

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 141 1.9e-56 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 506 6.88e-34 SMART
Blast:HOLI 507 537 8e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000110421
AA Change: D489G

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106051
Gene: ENSMUSG00000021055
AA Change: D489G

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 4.2e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 488 5.99e-34 SMART
Blast:HOLI 489 519 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133564
SMART Domains Protein: ENSMUSP00000138637
Gene: ENSMUSG00000021055

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 1.1e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
PDB:2J7Y|A 274 337 1e-33 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000218621
AA Change: D526G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neural, behavior, glucose homeostasis, sex-specific nociception, cardiac, and ion channel abnormalities and myeloproliferative disorders. Females are sterile/subfertile with granulosa cell defects; males show prostate hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,283,229 Q1205* probably null Het
Als2 A G 1: 59,170,557 F1422S possibly damaging Het
Anapc4 T C 5: 52,835,751 V68A possibly damaging Het
Atmin T C 8: 116,957,038 F479S probably damaging Het
Atp7b T C 8: 22,028,085 T234A probably benign Het
Bpifa1 G A 2: 154,145,661 G144S probably damaging Het
Brf2 A T 8: 27,124,558 M200K probably benign Het
C1ql2 G A 1: 120,341,215 C33Y probably damaging Het
Cdk18 A G 1: 132,117,581 V269A probably damaging Het
Clcc1 T C 3: 108,673,309 V313A probably damaging Het
Cntrl A T 2: 35,162,833 T1117S probably benign Het
Col15a1 G A 4: 47,247,533 E236K probably damaging Het
Comp T C 8: 70,376,514 L278P probably damaging Het
Dlg5 C A 14: 24,149,430 D1469Y probably damaging Het
Efna1 A T 3: 89,279,475 V23D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epb41l4b T C 4: 57,040,915 Y516C probably damaging Het
Fam184b T C 5: 45,555,135 T514A probably benign Het
Fcmr A C 1: 130,875,987 E176A possibly damaging Het
Fry T A 5: 150,416,220 N1485K possibly damaging Het
Fut2 A G 7: 45,650,881 C156R probably damaging Het
Gm10031 C T 1: 156,524,549 R107* probably null Het
Gm5431 T C 11: 48,895,200 Y116C probably benign Het
Gm5493 T A 17: 22,748,074 V61E possibly damaging Het
Golga4 A T 9: 118,548,779 Q456L probably damaging Het
Gpam T C 19: 55,074,609 Y757C probably damaging Het
Iqcg C T 16: 33,030,804 A266T probably benign Het
Lta4h G T 10: 93,471,897 G331* probably null Het
Macf1 C A 4: 123,408,745 V655F probably benign Het
Map3k13 T A 16: 21,922,150 D742E probably benign Het
Mrgprb2 G A 7: 48,552,849 L43F probably damaging Het
N4bp1 T C 8: 86,844,833 R846G probably damaging Het
Nbn T C 4: 15,970,863 I282T probably benign Het
Ncor1 C T 11: 62,353,233 probably null Het
Olfr1250 G T 2: 89,656,665 P259T probably damaging Het
Olfr1426 A G 19: 12,088,756 F12S possibly damaging Het
Olfr874 T A 9: 37,746,137 M1K probably null Het
Pclo A G 5: 14,681,962 probably benign Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Ptch1 T C 13: 63,525,067 Y771C possibly damaging Het
R3hcc1l G A 19: 42,562,845 D94N probably damaging Het
Rnpep T A 1: 135,263,120 K602* probably null Het
Rph3al T C 11: 75,854,450 Y156C probably damaging Het
Rundc1 A T 11: 101,433,911 Y481F possibly damaging Het
Serpinb9f A G 13: 33,325,876 K17R possibly damaging Het
Smpd3 T C 8: 106,259,881 H459R probably damaging Het
Spata31 A C 13: 64,922,834 Q932P possibly damaging Het
Srgap3 C T 6: 112,723,129 A963T probably damaging Het
Syne1 A T 10: 5,229,120 F4451L possibly damaging Het
Tbc1d19 T A 5: 53,856,924 probably null Het
Thap12 T A 7: 98,715,462 V279D probably damaging Het
Tmprss6 T C 15: 78,444,128 D544G probably damaging Het
Tox2 A G 2: 163,323,010 *523W probably null Het
Txnrd1 T C 10: 82,881,818 I212T probably benign Het
Unc80 T C 1: 66,646,566 I2283T probably benign Het
Vmn1r176 A G 7: 23,835,674 I18T possibly damaging Het
Vmn2r101 C T 17: 19,591,022 T456I probably benign Het
Vmn2r79 T A 7: 87,001,892 H166Q probably benign Het
Zer1 A G 2: 30,101,047 V723A possibly damaging Het
Other mutations in Esr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Esr2 APN 12 76133896 missense probably damaging 1.00
IGL00435:Esr2 APN 12 76133879 missense probably damaging 1.00
IGL01591:Esr2 APN 12 76121724 utr 3 prime probably benign
IGL01695:Esr2 APN 12 76145319 missense probably damaging 1.00
IGL02142:Esr2 APN 12 76123195 missense probably benign 0.02
IGL02343:Esr2 APN 12 76145345 missense probably benign 0.01
IGL02584:Esr2 APN 12 76145262 missense probably damaging 1.00
R0380:Esr2 UTSW 12 76123291 missense possibly damaging 0.81
R0975:Esr2 UTSW 12 76145308 missense possibly damaging 0.49
R2075:Esr2 UTSW 12 76165447 critical splice donor site probably null
R3881:Esr2 UTSW 12 76167620 missense probably damaging 0.96
R4475:Esr2 UTSW 12 76133942 missense probably benign 0.04
R4520:Esr2 UTSW 12 76167549 missense possibly damaging 0.91
R4636:Esr2 UTSW 12 76123324 missense possibly damaging 0.50
R5167:Esr2 UTSW 12 76123274 missense probably benign 0.00
R6163:Esr2 UTSW 12 76121869 missense probably damaging 1.00
R6928:Esr2 UTSW 12 76165478 missense probably damaging 1.00
R7441:Esr2 UTSW 12 76141394 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTACATGTCCCACTTCTGACC -3'
(R):5'- CTGGATGCATGAACAACAGACC -3'

Sequencing Primer
(F):5'- GACCATCATTGTAATCATCCGC -3'
(R):5'- TGCATGAACAACAGACCAATGG -3'
Posted On2018-11-28