Incidental Mutation 'R6966:Setd7'
ID541985
Institutional Source Beutler Lab
Gene Symbol Setd7
Ensembl Gene ENSMUSG00000037111
Gene NameSET domain containing (lysine methyltransferase) 7
SynonymsKMT7, Set7, 1600028F23Rik, Set7/9
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6966 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location51515319-51560879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51530184 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 217 (Y217H)
Ref Sequence ENSEMBL: ENSMUSP00000043492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037141]
Predicted Effect probably damaging
Transcript: ENSMUST00000037141
AA Change: Y217H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043492
Gene: ENSMUSG00000037111
AA Change: Y217H

DomainStartEndE-ValueType
Pfam:MORN 13 35 9e-3 PFAM
Pfam:MORN 36 58 1.7e-6 PFAM
Pfam:MORN 60 81 1.6e-6 PFAM
Pfam:MORN 106 128 2.2e-6 PFAM
SET 214 342 2.35e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele exhibit partial prenatal lethality and failure of mouse embryonic fibroblasts and spleen cells to arrest after doxorubicin treatment. Homozygotes for a different knock-out allele show resistance to bleomycin- or adenovirus-TGFbeta-induced pulmonary fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Catsper3 T A 13: 55,798,859 I123N probably damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Cnot1 A T 8: 95,724,532 L2189Q probably damaging Het
Csnk2b T A 17: 35,117,782 I170L probably benign Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Drd1 T C 13: 54,053,545 I210V probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hs6st1 G A 1: 36,104,218 W411* probably null Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Mical1 A T 10: 41,479,754 Q198L probably damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Olfr798 A G 10: 129,625,764 V99A probably benign Het
Pias3 A G 3: 96,702,195 D276G probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Setd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Setd7 APN 3 51550308 missense probably benign 0.00
IGL00940:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL00943:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL00944:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL01466:Setd7 APN 3 51521309 makesense probably null
IGL01810:Setd7 APN 3 51532967 splice site probably benign
IGL01884:Setd7 APN 3 51542711 missense possibly damaging 0.71
IGL02117:Setd7 APN 3 51521405 missense probably damaging 1.00
IGL02806:Setd7 APN 3 51550267 missense probably damaging 0.97
IGL03258:Setd7 APN 3 51560515 splice site probably null
IGL03404:Setd7 APN 3 51532986 nonsense probably null
R0366:Setd7 UTSW 3 51550320 missense probably benign 0.07
R1328:Setd7 UTSW 3 51542819 missense possibly damaging 0.95
R1819:Setd7 UTSW 3 51542639 missense probably benign 0.38
R1872:Setd7 UTSW 3 51542831 missense probably benign 0.29
R2406:Setd7 UTSW 3 51542676 missense probably damaging 0.99
R2513:Setd7 UTSW 3 51533015 missense probably damaging 1.00
R4231:Setd7 UTSW 3 51542730 missense probably benign 0.24
R4627:Setd7 UTSW 3 51542665 missense probably damaging 0.99
R4687:Setd7 UTSW 3 51550355 missense probably damaging 1.00
R4770:Setd7 UTSW 3 51521422 missense probably damaging 1.00
R5212:Setd7 UTSW 3 51542817 missense probably damaging 1.00
R5472:Setd7 UTSW 3 51521465 missense probably benign 0.00
R6127:Setd7 UTSW 3 51530081 missense probably damaging 1.00
R6647:Setd7 UTSW 3 51542762 missense probably benign 0.00
R7744:Setd7 UTSW 3 51526840 splice site probably null
R7828:Setd7 UTSW 3 51536657 critical splice acceptor site probably null
R7896:Setd7 UTSW 3 51536656 critical splice acceptor site probably null
R7979:Setd7 UTSW 3 51536656 critical splice acceptor site probably null
X0022:Setd7 UTSW 3 51542652 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATGACCATGAAAGTGGCTTGC -3'
(R):5'- AGAGTTCAGTTTGAATACAGCGC -3'

Sequencing Primer
(F):5'- CCATGAAAGTGGCTTGCTTAAGC -3'
(R):5'- CAGTTTGAATACAGCGCTTGCAG -3'
Posted On2018-11-28