Mutagenetix > Incidental Mutations

Incidental Mutation 'R6966:Adam26b'

541998

Institutional Source

Beutler Lab

Gene Symbol

Adam26b

Ensembl Gene

ENSMUSG00000063900

Gene Name

a disintegrin and metallopeptidase domain 26B

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R6966 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43519762-43528106 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43521435 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 177 (R177C)

Ref Sequence

ENSEMBL: ENSMUSP00000079032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080135]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080135
AA Change: R177C

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: R177C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	29	147	4.9e-18	PFAM
Pfam:Reprolysin_5	193	364	4.8e-15	PFAM
Pfam:Reprolysin_4	194	380	1.3e-8	PFAM
Pfam:Reprolysin	195	385	9.9e-50	PFAM
Pfam:Reprolysin_2	215	377	3.9e-15	PFAM
Pfam:Reprolysin_3	219	340	2e-15	PFAM
DISIN	401	476	5.88e-40	SMART
ACR	477	613	7.69e-64	SMART
low complexity region	631	642	N/A	INTRINSIC
transmembrane domain	670	692	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb2	CG	C	4: 130,014,362		probably null	Het
Bahcc1	G	A	11: 120,283,159	V1582M	probably damaging	Het
Baiap2	A	T	11: 120,006,405	R529*	probably null	Het
Bcl9l	C	T	9: 44,509,388	Q1327*	probably null	Het
Brsk2	T	A	7: 141,984,533	C139S	possibly damaging	Het
Catsper3	T	A	13: 55,798,859	I123N	probably damaging	Het
Cd84	A	G	1: 171,886,409	N325D	possibly damaging	Het
Chid1	T	A	7: 141,496,384	Y357F	possibly damaging	Het
Clstn2	A	T	9: 97,526,406	Y416*	probably null	Het
Cnot1	A	T	8: 95,724,532	L2189Q	probably damaging	Het
Csnk2b	T	A	17: 35,117,782	I170L	probably benign	Het
Dnah3	T	C	7: 120,032,754	Q1326R	probably damaging	Het
Drd1	T	C	13: 54,053,545	I210V	probably damaging	Het
Eef1d	G	T	15: 75,903,709	Q34K	probably benign	Het
Fam184a	T	C	10: 53,654,999	T760A	probably benign	Het
Fnip1	G	T	11: 54,482,559	V199F	probably benign	Het
Glyatl3	T	C	17: 40,904,938	K226E	probably damaging	Het
Gm19410	C	T	8: 35,817,973	T2093I	possibly damaging	Het
Herc1	A	T	9: 66,411,065	E1206D	probably benign	Het
Hs6st1	G	A	1: 36,104,218	W411*	probably null	Het
Hsf2	C	A	10: 57,495,984	S60R	probably damaging	Het
Hyal5	C	A	6: 24,891,292	N368K	probably damaging	Het
Itgb2l	A	T	16: 96,430,643	F308I	probably benign	Het
Kdm7a	G	A	6: 39,152,839	L468F	probably damaging	Het
Lamp3	A	T	16: 19,699,653	L278*	probably null	Het
Ly6c1	A	T	15: 75,045,440		probably benign	Het
Mark3	A	G	12: 111,640,024	N524D	probably damaging	Het
Met	T	G	6: 17,531,532	L603R	possibly damaging	Het
Mical1	A	T	10: 41,479,754	Q198L	probably damaging	Het
Nacad	T	A	11: 6,602,634	I186F	possibly damaging	Het
Nt5c3b	A	T	11: 100,429,924	M257K	probably benign	Het
Nuak2	T	C	1: 132,325,032	M108T	possibly damaging	Het
Nub1	T	A	5: 24,689,472	Y51N	probably damaging	Het
Nxpe5	T	C	5: 138,239,417	S68P	probably damaging	Het
Olfr1124	C	T	2: 87,435,279	T264I	probably damaging	Het
Olfr1174-ps	A	G	2: 88,311,491	S102P	probably benign	Het
Olfr798	A	G	10: 129,625,764	V99A	probably benign	Het
Pias3	A	G	3: 96,702,195	D276G	probably damaging	Het
Setd7	A	G	3: 51,530,184	Y217H	probably damaging	Het
Slc23a1	A	T	18: 35,625,061	I142N	probably damaging	Het
Slx4ip	T	C	2: 137,068,224	S310P	probably damaging	Het
Tcp11l2	G	A	10: 84,591,269	R199Q	possibly damaging	Het
Tgm4	T	A	9: 123,051,142	D226E	possibly damaging	Het
Tspyl4	C	A	10: 34,297,677	A55E	probably benign	Het
Uap1l1	A	G	2: 25,364,938	I146T	probably damaging	Het
Ush2a	G	A	1: 188,576,244	G2030D	probably damaging	Het
Uts2r	G	A	11: 121,161,387	G359D	possibly damaging	Het
Vwa7	T	C	17: 35,017,096	S9P	probably benign	Het
Zbtb16	A	G	9: 48,657,354	C604R	probably damaging	Het
Zfp804b	A	G	5: 6,771,615	S483P	probably damaging	Het
Zfpm1	G	A	8: 122,332,165	A175T	probably damaging	Het

Other mutations in Adam26b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Adam26b	APN	8	43520179	missense	probably damaging	1.00
IGL00806:Adam26b	APN	8	43521342	missense	probably damaging	1.00
IGL00984:Adam26b	APN	8	43520373	missense	possibly damaging	0.86
IGL01081:Adam26b	APN	8	43519938	missense	probably benign	0.00
IGL01783:Adam26b	APN	8	43521761	missense	probably benign	0.30
IGL02021:Adam26b	APN	8	43519872	missense	probably benign
IGL02707:Adam26b	APN	8	43519858	utr 3 prime	probably benign
IGL03112:Adam26b	APN	8	43521512	missense	probably benign
R0195:Adam26b	UTSW	8	43520270	missense	probably damaging	0.99
R0453:Adam26b	UTSW	8	43520350	missense	probably benign	0.00
R0562:Adam26b	UTSW	8	43520371	missense	probably benign	0.36
R0645:Adam26b	UTSW	8	43520487	missense	probably damaging	1.00
R0763:Adam26b	UTSW	8	43520564	missense	probably damaging	1.00
R1697:Adam26b	UTSW	8	43520963	missense	probably damaging	0.98
R1739:Adam26b	UTSW	8	43521677	missense	probably damaging	1.00
R1751:Adam26b	UTSW	8	43519911	missense	probably benign	0.00
R1767:Adam26b	UTSW	8	43519911	missense	probably benign	0.00
R1994:Adam26b	UTSW	8	43520639	missense	probably benign	0.44
R3747:Adam26b	UTSW	8	43521197	missense	probably benign	0.07
R3748:Adam26b	UTSW	8	43521197	missense	probably benign	0.07
R3750:Adam26b	UTSW	8	43521197	missense	probably benign	0.07
R3771:Adam26b	UTSW	8	43520714	missense	probably damaging	1.00
R4027:Adam26b	UTSW	8	43520372	missense	probably benign	0.09
R4652:Adam26b	UTSW	8	43521338	missense	possibly damaging	0.49
R4790:Adam26b	UTSW	8	43520727	missense	probably benign	0.19
R4859:Adam26b	UTSW	8	43520259	missense	possibly damaging	0.80
R5059:Adam26b	UTSW	8	43520600	missense	probably damaging	1.00
R5191:Adam26b	UTSW	8	43519991	missense	probably damaging	1.00
R5540:Adam26b	UTSW	8	43521617	missense	probably damaging	1.00
R5568:Adam26b	UTSW	8	43520492	missense	probably benign	0.00
R5886:Adam26b	UTSW	8	43520273	missense	possibly damaging	0.72
R5935:Adam26b	UTSW	8	43521298	missense	probably benign	0.00
R5983:Adam26b	UTSW	8	43521341	missense	probably damaging	1.00
R6544:Adam26b	UTSW	8	43521781	missense	probably damaging	0.98
R6610:Adam26b	UTSW	8	43521153	missense	probably damaging	1.00
R6668:Adam26b	UTSW	8	43520690	missense	possibly damaging	0.72
R7545:Adam26b	UTSW	8	43521713	missense	probably damaging	0.98
R7596:Adam26b	UTSW	8	43520200	missense	probably benign
R7634:Adam26b	UTSW	8	43520997	missense	probably benign
R7657:Adam26b	UTSW	8	43521542	missense	possibly damaging	0.95
R7692:Adam26b	UTSW	8	43520795	missense	probably benign	0.00
R7769:Adam26b	UTSW	8	43521695	missense	probably benign	0.00
R7912:Adam26b	UTSW	8	43520208	missense	probably benign	0.13
R7993:Adam26b	UTSW	8	43520208	missense	probably benign	0.13
X0066:Adam26b	UTSW	8	43520004	missense	probably damaging	0.97
Z1088:Adam26b	UTSW	8	43520597	missense	probably damaging	0.99
Z1177:Adam26b	UTSW	8	43520698	missense	not run
Z1177:Adam26b	UTSW	8	43521422	missense	not run

Predicted Primers

PCR Primer
(F):5'- TTGCTTCCAAGTACAGAAATCACC -3'
(R):5'- AGCTTGCAAGGCACACTAGAG -3'

Sequencing Primer
(F):5'- TTTCAAGAGCAGTTAAAACCACATC -3'
(R):5'- CTTGCAAGGCACACTAGAGATAAATG -3'

Posted On

2018-11-28