Mutagenetix > Incidental Mutation

Incidental Mutation 'R6966:Zbtb16'

542002

Institutional Source

Beutler Lab

Gene Symbol

Zbtb16

Ensembl Gene

ENSMUSG00000066687

Gene Name

zinc finger and BTB domain containing 16

Synonyms

Green's luxoid, Zfp145, PLZF

MMRRC Submission

045076-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.682) question?

Stock #

R6966 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48654297-48836222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48657354 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 604 (C604R)

Ref Sequence

ENSEMBL: ENSMUSP00000150887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]

AlphaFold

Q3UQ17

Predicted Effect

probably damaging
Transcript: ENSMUST00000093852
AA Change: C604R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: C604R

Domain	Start	End	E-Value	Type
BTB	34	126	1.41e-24	SMART
ZnF_C2H2	404	426	3.72e0	SMART
ZnF_C2H2	432	454	8.22e-2	SMART
ZnF_C2H2	461	483	2.24e-3	SMART
ZnF_C2H2	490	512	1.56e-2	SMART
ZnF_C2H2	518	540	1.63e-5	SMART
ZnF_C2H2	546	568	1.95e-3	SMART
ZnF_C2H2	574	596	5.9e-3	SMART
ZnF_C2H2	602	624	2.36e-2	SMART
ZnF_C2H2	630	652	2.24e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000216150
AA Change: C604R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26b	G	A	8: 43,521,435 (GRCm38)	R177C	possibly damaging	Het
Adgrb2	CG	C	4: 130,014,362 (GRCm38)		probably null	Het
Bahcc1	G	A	11: 120,283,159 (GRCm38)	V1582M	probably damaging	Het
Baiap2	A	T	11: 120,006,405 (GRCm38)	R529*	probably null	Het
Bcl9l	C	T	9: 44,509,388 (GRCm38)	Q1327*	probably null	Het
Brsk2	T	A	7: 141,984,533 (GRCm38)	C139S	possibly damaging	Het
Catsper3	T	A	13: 55,798,859 (GRCm38)	I123N	probably damaging	Het
Cd84	A	G	1: 171,886,409 (GRCm38)	N325D	possibly damaging	Het
Chid1	T	A	7: 141,496,384 (GRCm38)	Y357F	possibly damaging	Het
Clstn2	A	T	9: 97,526,406 (GRCm38)	Y416*	probably null	Het
Cnot1	A	T	8: 95,724,532 (GRCm38)	L2189Q	probably damaging	Het
Csnk2b	T	A	17: 35,117,782 (GRCm38)	I170L	probably benign	Het
Dnah3	T	C	7: 120,032,754 (GRCm38)	Q1326R	probably damaging	Het
Drd1	T	C	13: 54,053,545 (GRCm38)	I210V	probably damaging	Het
Eef1d	G	T	15: 75,903,709 (GRCm38)	Q34K	probably benign	Het
Fam184a	T	C	10: 53,654,999 (GRCm38)	T760A	probably benign	Het
Fnip1	G	T	11: 54,482,559 (GRCm38)	V199F	probably benign	Het
Glyatl3	T	C	17: 40,904,938 (GRCm38)	K226E	probably damaging	Het
Gm19410	C	T	8: 35,817,973 (GRCm38)	T2093I	possibly damaging	Het
Herc1	A	T	9: 66,411,065 (GRCm38)	E1206D	probably benign	Het
Hs6st1	G	A	1: 36,104,218 (GRCm38)	W411*	probably null	Het
Hsf2	C	A	10: 57,495,984 (GRCm38)	S60R	probably damaging	Het
Hyal5	C	A	6: 24,891,292 (GRCm38)	N368K	probably damaging	Het
Itgb2l	A	T	16: 96,430,643 (GRCm38)	F308I	probably benign	Het
Kdm7a	G	A	6: 39,152,839 (GRCm38)	L468F	probably damaging	Het
Lamp3	A	T	16: 19,699,653 (GRCm38)	L278*	probably null	Het
Ly6c1	A	T	15: 75,045,440 (GRCm38)		probably benign	Het
Mark3	A	G	12: 111,640,024 (GRCm38)	N524D	probably damaging	Het
Met	T	G	6: 17,531,532 (GRCm38)	L603R	possibly damaging	Het
Mical1	A	T	10: 41,479,754 (GRCm38)	Q198L	probably damaging	Het
Nacad	T	A	11: 6,602,634 (GRCm38)	I186F	possibly damaging	Het
Nt5c3b	A	T	11: 100,429,924 (GRCm38)	M257K	probably benign	Het
Nuak2	T	C	1: 132,325,032 (GRCm38)	M108T	possibly damaging	Het
Nub1	T	A	5: 24,689,472 (GRCm38)	Y51N	probably damaging	Het
Nxpe5	T	C	5: 138,239,417 (GRCm38)	S68P	probably damaging	Het
Olfr1124	C	T	2: 87,435,279 (GRCm38)	T264I	probably damaging	Het
Olfr1174-ps	A	G	2: 88,311,491 (GRCm38)	S102P	probably benign	Het
Olfr798	A	G	10: 129,625,764 (GRCm38)	V99A	probably benign	Het
Pias3	A	G	3: 96,702,195 (GRCm38)	D276G	probably damaging	Het
Setd7	A	G	3: 51,530,184 (GRCm38)	Y217H	probably damaging	Het
Slc23a1	A	T	18: 35,625,061 (GRCm38)	I142N	probably damaging	Het
Slx4ip	T	C	2: 137,068,224 (GRCm38)	S310P	probably damaging	Het
Tcp11l2	G	A	10: 84,591,269 (GRCm38)	R199Q	possibly damaging	Het
Tgm4	T	A	9: 123,051,142 (GRCm38)	D226E	possibly damaging	Het
Tspyl4	C	A	10: 34,297,677 (GRCm38)	A55E	probably benign	Het
Uap1l1	A	G	2: 25,364,938 (GRCm38)	I146T	probably damaging	Het
Ush2a	G	A	1: 188,576,244 (GRCm38)	G2030D	probably damaging	Het
Uts2r	G	A	11: 121,161,387 (GRCm38)	G359D	possibly damaging	Het
Vwa7	T	C	17: 35,017,096 (GRCm38)	S9P	probably benign	Het
Zfp804b	A	G	5: 6,771,615 (GRCm38)	S483P	probably damaging	Het
Zfpm1	G	A	8: 122,332,165 (GRCm38)	A175T	probably damaging	Het

Other mutations in Zbtb16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01977:Zbtb16	APN	9	48,657,183 (GRCm38)	missense	probably damaging	1.00
R0324:Zbtb16	UTSW	9	48,665,275 (GRCm38)	missense	possibly damaging	0.82
R0364:Zbtb16	UTSW	9	48,743,576 (GRCm38)	splice site	probably benign
R1538:Zbtb16	UTSW	9	48,832,283 (GRCm38)	missense	probably benign
R1575:Zbtb16	UTSW	9	48,832,272 (GRCm38)	missense	probably damaging	0.96
R1937:Zbtb16	UTSW	9	48,659,778 (GRCm38)	missense	probably benign
R2656:Zbtb16	UTSW	9	48,832,688 (GRCm38)	missense	probably damaging	1.00
R4176:Zbtb16	UTSW	9	48,659,801 (GRCm38)	missense	probably damaging	1.00
R4582:Zbtb16	UTSW	9	48,832,082 (GRCm38)	missense	probably benign
R4595:Zbtb16	UTSW	9	48,832,080 (GRCm38)	missense	possibly damaging	0.79
R6466:Zbtb16	UTSW	9	48,665,319 (GRCm38)	missense	possibly damaging	0.95
R7596:Zbtb16	UTSW	9	48,832,404 (GRCm38)	missense	possibly damaging	0.93
R7751:Zbtb16	UTSW	9	48,743,469 (GRCm38)	missense	probably damaging	1.00
R7904:Zbtb16	UTSW	9	48,832,972 (GRCm38)	missense	probably damaging	1.00
R8922:Zbtb16	UTSW	9	48,832,557 (GRCm38)	missense	probably benign
Z1176:Zbtb16	UTSW	9	48,657,288 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTAGAGGTACGTCTTCTCTATCC -3'
(R):5'- GTGAAGTGCCACAATGACCAG -3'

Sequencing Primer
(F):5'- CTCCAGTCAGGTGGGATCTC -3'
(R):5'- AGACCACTAGGCCTGTGTG -3'

Posted On

2018-11-28