Mutagenetix > Incidental Mutation

Incidental Mutation 'R6966:Tgm4'

542005

Institutional Source

Beutler Lab

Gene Symbol

Tgm4

Ensembl Gene

ENSMUSG00000025787

Gene Name

transglutaminase 4 (prostate)

Synonyms

9530008N10Rik, Eapa1, experimental autoimmune prostatitis antigen 1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R6966 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123034726-123067561 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 123051142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 226 (D226E)

Ref Sequence

ENSEMBL: ENSMUSP00000026893 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026893
AA Change: D226E

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: D226E

Domain	Start	End	E-Value	Type
Pfam:Transglut_N	8	118	4e-26	PFAM
TGc	247	340	6.25e-42	SMART
Pfam:Transglut_C	573	670	3e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215247

Predicted Effect

probably benign
Transcript: ENSMUST00000217607

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26b	G	A	8: 43,521,435	R177C	possibly damaging	Het
Adgrb2	CG	C	4: 130,014,362		probably null	Het
Bahcc1	G	A	11: 120,283,159	V1582M	probably damaging	Het
Baiap2	A	T	11: 120,006,405	R529*	probably null	Het
Bcl9l	C	T	9: 44,509,388	Q1327*	probably null	Het
Brsk2	T	A	7: 141,984,533	C139S	possibly damaging	Het
Catsper3	T	A	13: 55,798,859	I123N	probably damaging	Het
Cd84	A	G	1: 171,886,409	N325D	possibly damaging	Het
Chid1	T	A	7: 141,496,384	Y357F	possibly damaging	Het
Clstn2	A	T	9: 97,526,406	Y416*	probably null	Het
Cnot1	A	T	8: 95,724,532	L2189Q	probably damaging	Het
Csnk2b	T	A	17: 35,117,782	I170L	probably benign	Het
Dnah3	T	C	7: 120,032,754	Q1326R	probably damaging	Het
Drd1	T	C	13: 54,053,545	I210V	probably damaging	Het
Eef1d	G	T	15: 75,903,709	Q34K	probably benign	Het
Fam184a	T	C	10: 53,654,999	T760A	probably benign	Het
Fnip1	G	T	11: 54,482,559	V199F	probably benign	Het
Glyatl3	T	C	17: 40,904,938	K226E	probably damaging	Het
Gm19410	C	T	8: 35,817,973	T2093I	possibly damaging	Het
Herc1	A	T	9: 66,411,065	E1206D	probably benign	Het
Hs6st1	G	A	1: 36,104,218	W411*	probably null	Het
Hsf2	C	A	10: 57,495,984	S60R	probably damaging	Het
Hyal5	C	A	6: 24,891,292	N368K	probably damaging	Het
Itgb2l	A	T	16: 96,430,643	F308I	probably benign	Het
Kdm7a	G	A	6: 39,152,839	L468F	probably damaging	Het
Lamp3	A	T	16: 19,699,653	L278*	probably null	Het
Ly6c1	A	T	15: 75,045,440		probably benign	Het
Mark3	A	G	12: 111,640,024	N524D	probably damaging	Het
Met	T	G	6: 17,531,532	L603R	possibly damaging	Het
Mical1	A	T	10: 41,479,754	Q198L	probably damaging	Het
Nacad	T	A	11: 6,602,634	I186F	possibly damaging	Het
Nt5c3b	A	T	11: 100,429,924	M257K	probably benign	Het
Nuak2	T	C	1: 132,325,032	M108T	possibly damaging	Het
Nub1	T	A	5: 24,689,472	Y51N	probably damaging	Het
Nxpe5	T	C	5: 138,239,417	S68P	probably damaging	Het
Olfr1124	C	T	2: 87,435,279	T264I	probably damaging	Het
Olfr1174-ps	A	G	2: 88,311,491	S102P	probably benign	Het
Olfr798	A	G	10: 129,625,764	V99A	probably benign	Het
Pias3	A	G	3: 96,702,195	D276G	probably damaging	Het
Setd7	A	G	3: 51,530,184	Y217H	probably damaging	Het
Slc23a1	A	T	18: 35,625,061	I142N	probably damaging	Het
Slx4ip	T	C	2: 137,068,224	S310P	probably damaging	Het
Tcp11l2	G	A	10: 84,591,269	R199Q	possibly damaging	Het
Tspyl4	C	A	10: 34,297,677	A55E	probably benign	Het
Uap1l1	A	G	2: 25,364,938	I146T	probably damaging	Het
Ush2a	G	A	1: 188,576,244	G2030D	probably damaging	Het
Uts2r	G	A	11: 121,161,387	G359D	possibly damaging	Het
Vwa7	T	C	17: 35,017,096	S9P	probably benign	Het
Zbtb16	A	G	9: 48,657,354	C604R	probably damaging	Het
Zfp804b	A	G	5: 6,771,615	S483P	probably damaging	Het
Zfpm1	G	A	8: 122,332,165	A175T	probably damaging	Het

Other mutations in Tgm4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Tgm4	APN	9	123062382	unclassified	probably benign
IGL01402:Tgm4	APN	9	123051454	missense	possibly damaging	0.82
IGL02000:Tgm4	APN	9	123056466	missense	probably damaging	1.00
IGL02120:Tgm4	APN	9	123046529	missense	probably damaging	0.98
IGL03130:Tgm4	APN	9	123056515	missense	probably damaging	1.00
IGL03188:Tgm4	APN	9	123045036	missense	probably null	0.06
R0329:Tgm4	UTSW	9	123048557	critical splice donor site	probably null
R0480:Tgm4	UTSW	9	123062419	missense	probably benign
R0644:Tgm4	UTSW	9	123051458	missense	probably damaging	1.00
R0990:Tgm4	UTSW	9	123046511	missense	probably benign	0.02
R1604:Tgm4	UTSW	9	123045064	missense	probably benign	0.39
R1644:Tgm4	UTSW	9	123051416	missense	probably damaging	1.00
R2056:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2058:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2059:Tgm4	UTSW	9	123061770	missense	probably damaging	1.00
R2076:Tgm4	UTSW	9	123051095	missense	probably benign	0.24
R2437:Tgm4	UTSW	9	123048549	nonsense	probably null
R4392:Tgm4	UTSW	9	123066752	missense	probably benign	0.10
R4407:Tgm4	UTSW	9	123056530	missense	probably damaging	1.00
R4752:Tgm4	UTSW	9	123051386	missense	probably damaging	1.00
R5288:Tgm4	UTSW	9	123056494	missense	probably damaging	1.00
R5365:Tgm4	UTSW	9	123066801	missense	probably damaging	1.00
R5386:Tgm4	UTSW	9	123056494	missense	probably damaging	1.00
R5790:Tgm4	UTSW	9	123061743	missense	probably damaging	0.98
R5890:Tgm4	UTSW	9	123061638	missense	probably damaging	1.00
R6102:Tgm4	UTSW	9	123056535	missense	probably benign
R6358:Tgm4	UTSW	9	123056518	missense	probably damaging	1.00
R6956:Tgm4	UTSW	9	123064703	missense	possibly damaging	0.93
R7091:Tgm4	UTSW	9	123040460	missense	probably damaging	1.00
R7258:Tgm4	UTSW	9	123062491	missense	probably benign	0.02
R7313:Tgm4	UTSW	9	123062491	missense	probably benign	0.02
R7369:Tgm4	UTSW	9	123056684	critical splice donor site	probably null
R7802:Tgm4	UTSW	9	123051336	intron	probably benign
R8219:Tgm4	UTSW	9	123045052	missense	probably benign
R8787:Tgm4	UTSW	9	123061845	missense	probably damaging	1.00
R8936:Tgm4	UTSW	9	123040476	missense	possibly damaging	0.92
R9045:Tgm4	UTSW	9	123048551	missense	possibly damaging	0.94
R9328:Tgm4	UTSW	9	123056632	missense	possibly damaging	0.93
R9359:Tgm4	UTSW	9	123052772	missense	probably damaging	1.00
R9403:Tgm4	UTSW	9	123052772	missense	probably damaging	1.00
R9471:Tgm4	UTSW	9	123040379	missense	probably benign
R9746:Tgm4	UTSW	9	123046569	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGTCTTACTATGTAGCTAGACCTGTTC -3'
(R):5'- TTAGTCACGCTTCGAGCTGG -3'

Sequencing Primer
(F):5'- GTAGCTAGACCTGTTCTTAAACTTGC -3'
(R):5'- TCTCAGTGCTGAAATGACCCAGG -3'

Posted On

2018-11-28