Mutagenetix > Incidental Mutations

Incidental Mutation 'R6966:Tcp11l2'

542010

Institutional Source

Beutler Lab

Gene Symbol

Tcp11l2

Ensembl Gene

ENSMUSG00000020034

Gene Name

t-complex 11 (mouse) like 2

Synonyms

E430026E19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R6966 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84576626-84614359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84591269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 199 (R199Q)

Ref Sequence

ENSEMBL: ENSMUSP00000020223 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020223]

AlphaFold

Q8K1H7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020223
AA Change: R199Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020223
Gene: ENSMUSG00000020034
AA Change: R199Q

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
low complexity region	36	55	N/A	INTRINSIC
Pfam:Tcp11	77	497	5.8e-103	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26b	G	A	8: 43,521,435	R177C	possibly damaging	Het
Adgrb2	CG	C	4: 130,014,362		probably null	Het
Bahcc1	G	A	11: 120,283,159	V1582M	probably damaging	Het
Baiap2	A	T	11: 120,006,405	R529*	probably null	Het
Bcl9l	C	T	9: 44,509,388	Q1327*	probably null	Het
Brsk2	T	A	7: 141,984,533	C139S	possibly damaging	Het
Catsper3	T	A	13: 55,798,859	I123N	probably damaging	Het
Cd84	A	G	1: 171,886,409	N325D	possibly damaging	Het
Chid1	T	A	7: 141,496,384	Y357F	possibly damaging	Het
Clstn2	A	T	9: 97,526,406	Y416*	probably null	Het
Cnot1	A	T	8: 95,724,532	L2189Q	probably damaging	Het
Csnk2b	T	A	17: 35,117,782	I170L	probably benign	Het
Dnah3	T	C	7: 120,032,754	Q1326R	probably damaging	Het
Drd1	T	C	13: 54,053,545	I210V	probably damaging	Het
Eef1d	G	T	15: 75,903,709	Q34K	probably benign	Het
Fam184a	T	C	10: 53,654,999	T760A	probably benign	Het
Fnip1	G	T	11: 54,482,559	V199F	probably benign	Het
Glyatl3	T	C	17: 40,904,938	K226E	probably damaging	Het
Gm19410	C	T	8: 35,817,973	T2093I	possibly damaging	Het
Herc1	A	T	9: 66,411,065	E1206D	probably benign	Het
Hs6st1	G	A	1: 36,104,218	W411*	probably null	Het
Hsf2	C	A	10: 57,495,984	S60R	probably damaging	Het
Hyal5	C	A	6: 24,891,292	N368K	probably damaging	Het
Itgb2l	A	T	16: 96,430,643	F308I	probably benign	Het
Kdm7a	G	A	6: 39,152,839	L468F	probably damaging	Het
Lamp3	A	T	16: 19,699,653	L278*	probably null	Het
Ly6c1	A	T	15: 75,045,440		probably benign	Het
Mark3	A	G	12: 111,640,024	N524D	probably damaging	Het
Met	T	G	6: 17,531,532	L603R	possibly damaging	Het
Mical1	A	T	10: 41,479,754	Q198L	probably damaging	Het
Nacad	T	A	11: 6,602,634	I186F	possibly damaging	Het
Nt5c3b	A	T	11: 100,429,924	M257K	probably benign	Het
Nuak2	T	C	1: 132,325,032	M108T	possibly damaging	Het
Nub1	T	A	5: 24,689,472	Y51N	probably damaging	Het
Nxpe5	T	C	5: 138,239,417	S68P	probably damaging	Het
Olfr1124	C	T	2: 87,435,279	T264I	probably damaging	Het
Olfr1174-ps	A	G	2: 88,311,491	S102P	probably benign	Het
Olfr798	A	G	10: 129,625,764	V99A	probably benign	Het
Pias3	A	G	3: 96,702,195	D276G	probably damaging	Het
Setd7	A	G	3: 51,530,184	Y217H	probably damaging	Het
Slc23a1	A	T	18: 35,625,061	I142N	probably damaging	Het
Slx4ip	T	C	2: 137,068,224	S310P	probably damaging	Het
Tgm4	T	A	9: 123,051,142	D226E	possibly damaging	Het
Tspyl4	C	A	10: 34,297,677	A55E	probably benign	Het
Uap1l1	A	G	2: 25,364,938	I146T	probably damaging	Het
Ush2a	G	A	1: 188,576,244	G2030D	probably damaging	Het
Uts2r	G	A	11: 121,161,387	G359D	possibly damaging	Het
Vwa7	T	C	17: 35,017,096	S9P	probably benign	Het
Zbtb16	A	G	9: 48,657,354	C604R	probably damaging	Het
Zfp804b	A	G	5: 6,771,615	S483P	probably damaging	Het
Zfpm1	G	A	8: 122,332,165	A175T	probably damaging	Het

Other mutations in Tcp11l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00725:Tcp11l2	APN	10	84594710	missense	possibly damaging	0.82
IGL00845:Tcp11l2	APN	10	84604983	missense	possibly damaging	0.95
IGL02375:Tcp11l2	APN	10	84605068	critical splice donor site	probably null
IGL02418:Tcp11l2	APN	10	84613606	nonsense	probably null
IGL03325:Tcp11l2	APN	10	84604900	missense	possibly damaging	0.76
R0031:Tcp11l2	UTSW	10	84591140	missense	probably damaging	0.98
R0591:Tcp11l2	UTSW	10	84604594	missense	probably benign	0.05
R1563:Tcp11l2	UTSW	10	84584944	missense	probably damaging	0.96
R1607:Tcp11l2	UTSW	10	84613487	missense	probably damaging	1.00
R1840:Tcp11l2	UTSW	10	84604599	missense	probably damaging	0.98
R2144:Tcp11l2	UTSW	10	84613499	missense	probably damaging	1.00
R2251:Tcp11l2	UTSW	10	84605069	critical splice donor site	probably null
R4289:Tcp11l2	UTSW	10	84605073	splice site	probably null
R4639:Tcp11l2	UTSW	10	84584936	missense	probably damaging	1.00
R4844:Tcp11l2	UTSW	10	84613691	missense	probably benign	0.00
R4973:Tcp11l2	UTSW	10	84591163	missense	probably damaging	0.98
R5264:Tcp11l2	UTSW	10	84613660	missense	probably damaging	1.00
R5970:Tcp11l2	UTSW	10	84594797	splice site	probably benign
R7250:Tcp11l2	UTSW	10	84587241	critical splice donor site	probably null
R7535:Tcp11l2	UTSW	10	84594659	missense	possibly damaging	0.67
R7565:Tcp11l2	UTSW	10	84587134	missense	probably damaging	1.00
R7619:Tcp11l2	UTSW	10	84594758	missense	probably damaging	1.00
R7774:Tcp11l2	UTSW	10	84604983	missense	possibly damaging	0.95
R8145:Tcp11l2	UTSW	10	84608616	missense	probably damaging	1.00
R8379:Tcp11l2	UTSW	10	84613605	missense	probably damaging	1.00
R8458:Tcp11l2	UTSW	10	84613532	nonsense	probably null
R8821:Tcp11l2	UTSW	10	84613658	missense	probably damaging	1.00
R8831:Tcp11l2	UTSW	10	84613658	missense	probably damaging	1.00
RF008:Tcp11l2	UTSW	10	84613524	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGCATAGCTTGTGGCATTG -3'
(R):5'- AACACACAGTGTCAAGGACTG -3'

Sequencing Primer
(F):5'- CATAGCTTGTGGCATTGGGGAC -3'
(R):5'- TCAAGGACTGACCGGCTC -3'

Posted On

2018-11-28