Incidental Mutation 'R6966:Drd1'
ID542019
Institutional Source Beutler Lab
Gene Symbol Drd1
Ensembl Gene ENSMUSG00000021478
Gene Namedopamine receptor D1
SynonymsDrd1a, D1 receptor, C030036C15Rik, Gpcr15, Drd-1
MMRRC Submission
Accession Numbers

Genbank: NM_010076.3; Ensembl: ENSMUST00000021932

Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R6966 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location54051183-54055705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54053545 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 210 (I210V)
Ref Sequence ENSEMBL: ENSMUSP00000152768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021932] [ENSMUST00000221470]
Predicted Effect probably damaging
Transcript: ENSMUST00000021932
AA Change: I217V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021932
Gene: ENSMUSG00000021478
AA Change: I217V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 33 244 7.9e-10 PFAM
Pfam:7TM_GPCR_Srsx 33 345 7e-11 PFAM
Pfam:7tm_1 39 331 6.5e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221470
AA Change: I210V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D1 subtype of the dopamine receptor. The D1 subtype is the most abundant dopamine receptor in the central nervous system. This G-protein coupled receptor stimulates adenylyl cyclase and activates cyclic AMP-dependent protein kinases. D1 receptors regulate neuronal growth and development, mediate some behavioral responses, and modulate dopamine receptor D2-mediated events. Alternate transcription initiation sites result in two transcript variants of this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations show variably abnormalities that may include growth retardation, death after weaning unless given hydrated food, nonresponsiveness to dopamine D1 receptor agonists and antagonists, and normal to hyperactive locomotor activity. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Catsper3 T A 13: 55,798,859 I123N probably damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Cnot1 A T 8: 95,724,532 L2189Q probably damaging Het
Csnk2b T A 17: 35,117,782 I170L probably benign Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hs6st1 G A 1: 36,104,218 W411* probably null Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Mical1 A T 10: 41,479,754 Q198L probably damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Olfr798 A G 10: 129,625,764 V99A probably benign Het
Pias3 A G 3: 96,702,195 D276G probably damaging Het
Setd7 A G 3: 51,530,184 Y217H probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Drd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Drd1 APN 13 54053878 missense probably damaging 1.00
IGL00231:Drd1 APN 13 54053467 missense probably benign
1mM(1):Drd1 UTSW 13 54053847 missense probably damaging 1.00
H8786:Drd1 UTSW 13 54053103 missense possibly damaging 0.92
R0166:Drd1 UTSW 13 54053581 missense probably damaging 1.00
R0333:Drd1 UTSW 13 54054063 missense probably damaging 1.00
R0661:Drd1 UTSW 13 54053038 missense possibly damaging 0.90
R1022:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1024:Drd1 UTSW 13 54053314 missense probably benign 0.00
R1397:Drd1 UTSW 13 54053554 missense probably damaging 1.00
R1559:Drd1 UTSW 13 54052945 missense probably damaging 0.99
R1907:Drd1 UTSW 13 54053252 missense possibly damaging 0.88
R2128:Drd1 UTSW 13 54053553 missense probably damaging 1.00
R4913:Drd1 UTSW 13 54053167 missense probably benign 0.33
R5592:Drd1 UTSW 13 54054171 start codon destroyed probably null 0.90
R5867:Drd1 UTSW 13 54054163 missense probably benign
R6758:Drd1 UTSW 13 54053289 missense probably benign
X0028:Drd1 UTSW 13 54053793 missense probably damaging 1.00
Z1177:Drd1 UTSW 13 54052857 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTGTCTTCAGGACTTTAGTCTCC -3'
(R):5'- CAGCCTTCATCCTGATTAGCG -3'

Sequencing Primer
(F):5'- AGGACTTTAGTCTCCCTCTTAAAGG -3'
(R):5'- TCATTCCAGTGCAGCTAAGC -3'
Posted On2018-11-28