Incidental Mutation 'R6966:Catsper3'
ID542020
Institutional Source Beutler Lab
Gene Symbol Catsper3
Ensembl Gene ENSMUSG00000021499
Gene Namecation channel, sperm associated 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6966 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55784568-55808998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55798859 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 123 (I123N)
Ref Sequence ENSEMBL: ENSMUSP00000021961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021961] [ENSMUST00000109898]
Predicted Effect probably damaging
Transcript: ENSMUST00000021961
AA Change: I123N

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021961
Gene: ENSMUSG00000021499
AA Change: I123N

DomainStartEndE-ValueType
Pfam:Ion_trans 49 277 1.8e-33 PFAM
Pfam:PKD_channel 144 273 5e-7 PFAM
coiled coil region 283 311 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109898
AA Change: I110N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105524
Gene: ENSMUSG00000021499
AA Change: I110N

DomainStartEndE-ValueType
Pfam:Ion_trans 72 254 4.9e-32 PFAM
Pfam:PKD_channel 125 261 2.1e-7 PFAM
coiled coil region 270 298 N/A INTRINSIC
low complexity region 374 382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for this mutation are viable and exhibit no gross physical or behavioral abnormality. Although wild-type and homozygous mutant females bred to wild-type males exhibit similar fertility, male homozygotes are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Cnot1 A T 8: 95,724,532 L2189Q probably damaging Het
Csnk2b T A 17: 35,117,782 I170L probably benign Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Drd1 T C 13: 54,053,545 I210V probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hs6st1 G A 1: 36,104,218 W411* probably null Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Mical1 A T 10: 41,479,754 Q198L probably damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Olfr798 A G 10: 129,625,764 V99A probably benign Het
Pias3 A G 3: 96,702,195 D276G probably damaging Het
Setd7 A G 3: 51,530,184 Y217H probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Catsper3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Catsper3 APN 13 55798822 missense possibly damaging 0.94
IGL01794:Catsper3 APN 13 55798906 missense possibly damaging 0.84
IGL02419:Catsper3 APN 13 55808068 missense possibly damaging 0.94
IGL03108:Catsper3 APN 13 55808035 missense probably benign 0.01
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R1870:Catsper3 UTSW 13 55805748 missense probably damaging 1.00
R2229:Catsper3 UTSW 13 55808054 missense probably damaging 1.00
R3055:Catsper3 UTSW 13 55808896 missense unknown
R3056:Catsper3 UTSW 13 55808896 missense unknown
R4092:Catsper3 UTSW 13 55784671 missense probably benign 0.00
R4113:Catsper3 UTSW 13 55786370 missense probably damaging 0.99
R5197:Catsper3 UTSW 13 55808176 critical splice donor site probably null
R6011:Catsper3 UTSW 13 55786492 missense probably damaging 0.96
R6064:Catsper3 UTSW 13 55806252 missense probably damaging 0.99
R6385:Catsper3 UTSW 13 55786426 missense probably damaging 0.99
R7128:Catsper3 UTSW 13 55798849 missense probably benign 0.00
R7373:Catsper3 UTSW 13 55808132 missense possibly damaging 0.87
R7565:Catsper3 UTSW 13 55784725 missense probably benign 0.10
Z1088:Catsper3 UTSW 13 55808104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCTGGGGCTCTGCATTTG -3'
(R):5'- TATCGGTCAAGTTTAACTGGCCAC -3'

Sequencing Primer
(F):5'- GTTTTGATCTCTAACCCCTGTGAC -3'
(R):5'- AGTCATTATTTCTTAGAAAGCCTCCC -3'
Posted On2018-11-28