Incidental Mutation 'R6966:Csnk2b'
ID542026
Institutional Source Beutler Lab
Gene Symbol Csnk2b
Ensembl Gene ENSMUSG00000024387
Gene Namecasein kinase 2, beta polypeptide
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6966 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35116196-35122053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35117782 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 170 (I170L)
Ref Sequence ENSEMBL: ENSMUSP00000134673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025246] [ENSMUST00000062657] [ENSMUST00000165306] [ENSMUST00000172765] [ENSMUST00000172854] [ENSMUST00000173043] [ENSMUST00000173114] [ENSMUST00000173380] [ENSMUST00000173915] [ENSMUST00000174024] [ENSMUST00000174306] [ENSMUST00000174779]
Predicted Effect silent
Transcript: ENSMUST00000025246
SMART Domains Protein: ENSMUSP00000025246
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062657
SMART Domains Protein: ENSMUSP00000052133
Gene: ENSMUSG00000043807

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CK_II_beta 21 115 1e-40 BLAST
Blast:CK_II_beta 125 170 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165306
SMART Domains Protein: ENSMUSP00000133240
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 4.36e-1 SMART
G_patch 246 292 1.45e-14 SMART
Predicted Effect silent
Transcript: ENSMUST00000172765
SMART Domains Protein: ENSMUSP00000134523
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 29 206 6.86e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172854
SMART Domains Protein: ENSMUSP00000138033
Gene: ENSMUSG00000043807

DomainStartEndE-ValueType
Blast:CK_II_beta 1 60 2e-18 BLAST
Blast:CK_II_beta 70 115 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173043
SMART Domains Protein: ENSMUSP00000135684
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 2.7e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000173114
SMART Domains Protein: ENSMUSP00000134218
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173380
SMART Domains Protein: ENSMUSP00000134694
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000173633
SMART Domains Protein: ENSMUSP00000133826
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 2 91 1.28e-26 SMART
Blast:CK_II_beta 121 154 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173915
SMART Domains Protein: ENSMUSP00000133425
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 58 6.45e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174024
AA Change: I170L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134673
Gene: ENSMUSG00000024387
AA Change: I170L

DomainStartEndE-ValueType
CK_II_beta 8 169 5.07e-71 SMART
Blast:CK_II_beta 189 220 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174306
SMART Domains Protein: ENSMUSP00000134413
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 122 3.01e-64 SMART
Predicted Effect silent
Transcript: ENSMUST00000174779
SMART Domains Protein: ENSMUSP00000133684
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 1 140 2.47e-83 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the casein kinase 2 enzyme, which is a heterotetramer comprised of alpha and/or alpha-prime catalytic subunits and two regulatory beta subunits. Casein kinase 2 is involved in the regulation of several cellular processes including gene expression, protein synthesis and cell proliferation. Knockout of this gene in mice leads to embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality post-implantation, growth retardation and arrest, a failure to form an inner cell mass and smaller size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,521,435 R177C possibly damaging Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Bahcc1 G A 11: 120,283,159 V1582M probably damaging Het
Baiap2 A T 11: 120,006,405 R529* probably null Het
Bcl9l C T 9: 44,509,388 Q1327* probably null Het
Brsk2 T A 7: 141,984,533 C139S possibly damaging Het
Catsper3 T A 13: 55,798,859 I123N probably damaging Het
Cd84 A G 1: 171,886,409 N325D possibly damaging Het
Chid1 T A 7: 141,496,384 Y357F possibly damaging Het
Clstn2 A T 9: 97,526,406 Y416* probably null Het
Cnot1 A T 8: 95,724,532 L2189Q probably damaging Het
Dnah3 T C 7: 120,032,754 Q1326R probably damaging Het
Drd1 T C 13: 54,053,545 I210V probably damaging Het
Eef1d G T 15: 75,903,709 Q34K probably benign Het
Fam184a T C 10: 53,654,999 T760A probably benign Het
Fnip1 G T 11: 54,482,559 V199F probably benign Het
Glyatl3 T C 17: 40,904,938 K226E probably damaging Het
Gm19410 C T 8: 35,817,973 T2093I possibly damaging Het
Herc1 A T 9: 66,411,065 E1206D probably benign Het
Hs6st1 G A 1: 36,104,218 W411* probably null Het
Hsf2 C A 10: 57,495,984 S60R probably damaging Het
Hyal5 C A 6: 24,891,292 N368K probably damaging Het
Itgb2l A T 16: 96,430,643 F308I probably benign Het
Kdm7a G A 6: 39,152,839 L468F probably damaging Het
Lamp3 A T 16: 19,699,653 L278* probably null Het
Ly6c1 A T 15: 75,045,440 probably benign Het
Mark3 A G 12: 111,640,024 N524D probably damaging Het
Met T G 6: 17,531,532 L603R possibly damaging Het
Mical1 A T 10: 41,479,754 Q198L probably damaging Het
Nacad T A 11: 6,602,634 I186F possibly damaging Het
Nt5c3b A T 11: 100,429,924 M257K probably benign Het
Nuak2 T C 1: 132,325,032 M108T possibly damaging Het
Nub1 T A 5: 24,689,472 Y51N probably damaging Het
Nxpe5 T C 5: 138,239,417 S68P probably damaging Het
Olfr1124 C T 2: 87,435,279 T264I probably damaging Het
Olfr1174-ps A G 2: 88,311,491 S102P probably benign Het
Olfr798 A G 10: 129,625,764 V99A probably benign Het
Pias3 A G 3: 96,702,195 D276G probably damaging Het
Setd7 A G 3: 51,530,184 Y217H probably damaging Het
Slc23a1 A T 18: 35,625,061 I142N probably damaging Het
Slx4ip T C 2: 137,068,224 S310P probably damaging Het
Tcp11l2 G A 10: 84,591,269 R199Q possibly damaging Het
Tgm4 T A 9: 123,051,142 D226E possibly damaging Het
Tspyl4 C A 10: 34,297,677 A55E probably benign Het
Uap1l1 A G 2: 25,364,938 I146T probably damaging Het
Ush2a G A 1: 188,576,244 G2030D probably damaging Het
Uts2r G A 11: 121,161,387 G359D possibly damaging Het
Vwa7 T C 17: 35,017,096 S9P probably benign Het
Zbtb16 A G 9: 48,657,354 C604R probably damaging Het
Zfp804b A G 5: 6,771,615 S483P probably damaging Het
Zfpm1 G A 8: 122,332,165 A175T probably damaging Het
Other mutations in Csnk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Csnk2b APN 17 35118016 missense possibly damaging 0.92
R2318:Csnk2b UTSW 17 35118061 missense possibly damaging 0.88
R7053:Csnk2b UTSW 17 35116446 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTTTGGGATAGGCAAGCCTC -3'
(R):5'- ATCGGTGAGTGTTGAAAGCC -3'

Sequencing Primer
(F):5'- CAAGAAAGGGCTATGCTTGTCCTC -3'
(R):5'- AGAAGCTGCCTTCCTGTACTCAG -3'
Posted On2018-11-28