Incidental Mutation 'R6967:Ptpn4'
ID542032
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R6967 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 119684581 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 27 (Y27*)
Ref Sequence ENSEMBL: ENSMUSP00000126216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000166624]
Predicted Effect probably null
Transcript: ENSMUST00000064091
AA Change: Y622*
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: Y622*

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166624
AA Change: Y27*
SMART Domains Protein: ENSMUSP00000126216
Gene: ENSMUSG00000026384
AA Change: Y27*

DomainStartEndE-ValueType
Blast:PTPc 1 65 1e-34 BLAST
PDB:2I75|A 15 67 2e-28 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik A G 7: 104,059,005 I199T probably benign Het
6430628N08Rik A G 4: 115,898,294 T97A unknown Het
Adam23 T G 1: 63,563,336 probably null Het
Adamts8 C T 9: 30,954,491 T445I probably benign Het
Ahi1 T C 10: 20,988,625 V752A probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Bicra T C 7: 15,972,205 E1437G probably damaging Het
Cdc42ep4 C T 11: 113,729,172 S131N possibly damaging Het
Ces1f G A 8: 93,267,997 P262L probably benign Het
Chrna2 A T 14: 66,150,949 probably null Het
Cspg4 G A 9: 56,890,136 V1295M possibly damaging Het
D5Ertd579e T C 5: 36,615,756 T432A probably benign Het
Dach1 A T 14: 97,903,197 S456R probably damaging Het
Dhx37 T C 5: 125,422,167 D659G probably benign Het
Dscaml1 T C 9: 45,674,523 V586A probably damaging Het
Efhb G T 17: 53,463,168 L38I probably benign Het
Fam208b A T 13: 3,574,819 D1710E probably benign Het
Fbxw10 T C 11: 62,847,603 S108P possibly damaging Het
Fmnl2 A G 2: 53,097,332 N313S possibly damaging Het
Gga3 T C 11: 115,591,276 E172G probably damaging Het
Ggta1 A G 2: 35,402,722 V191A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hcn4 C T 9: 58,823,945 T145M unknown Het
Kirrel3 T C 9: 35,034,906 S654P probably damaging Het
Klrb1 A T 6: 128,710,523 probably null Het
Krt15 T A 11: 100,134,513 D166V probably damaging Het
Lipk T A 19: 34,040,394 Y277* probably null Het
Ly6g A C 15: 75,158,549 N49T possibly damaging Het
Ms4a4c A T 19: 11,414,827 Q4L probably benign Het
Nfya A C 17: 48,392,904 probably benign Het
Nub1 T C 5: 24,708,711 V530A probably benign Het
Ocln A T 13: 100,539,288 Y232* probably null Het
Olfr1129 A G 2: 87,575,513 N143S possibly damaging Het
Olfr1468-ps1 A G 19: 13,375,451 H163R unknown Het
Olfr456 A G 6: 42,487,013 F60S probably damaging Het
Olfr462 C T 11: 87,889,498 V133I probably benign Het
Otogl G A 10: 107,814,050 A1148V probably benign Het
Paqr5 C T 9: 61,972,831 W46* probably null Het
Psd2 C A 18: 35,980,332 L286M probably damaging Het
Ripk2 A G 4: 16,158,275 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sbk2 C T 7: 4,964,147 probably null Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sspo A C 6: 48,489,794 D4072A probably benign Het
St6galnac3 T C 3: 153,206,708 Y214C probably damaging Het
Sugp1 T A 8: 70,060,552 D256E possibly damaging Het
Sugt1 A G 14: 79,597,407 Y90C probably benign Het
Taok2 A G 7: 126,870,392 I1088T probably damaging Het
Tmc7 T A 7: 118,547,678 T459S probably benign Het
Tmed11 T C 5: 108,778,914 Y164C probably damaging Het
Tmem63b T C 17: 45,666,632 E356G probably benign Het
Ttc13 T C 8: 124,688,618 I261V probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn1r73 A T 7: 11,756,617 K121* probably null Het
Zc3h12d A T 10: 7,839,880 S16C probably damaging Het
Zfp292 A T 4: 34,807,812 M1744K probably damaging Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
hash UTSW 1 119765919 nonsense probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
R7732:Ptpn4 UTSW 1 119692802 missense probably benign
R7794:Ptpn4 UTSW 1 119726037 missense probably damaging 1.00
R8061:Ptpn4 UTSW 1 119691600 critical splice donor site probably null
RF014:Ptpn4 UTSW 1 119684465 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCACAGTAGATTAGGCCCTAAAC -3'
(R):5'- TTTTCCAAAGGAATAGCAACCC -3'

Sequencing Primer
(F):5'- GTAGATTAGGCCCTAAACAACCCTC -3'
(R):5'- GTCATTCTTGTTTCCTACACAAAGG -3'
Posted On2018-11-28