Incidental Mutation 'R6967:Zc3h12d'
ID542064
Institutional Source Beutler Lab
Gene Symbol Zc3h12d
Ensembl Gene ENSMUSG00000039981
Gene Namezinc finger CCCH type containing 12D
SynonymsD730019B10Rik, TFL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6967 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location7832470-7870396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7839880 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 16 (S16C)
Ref Sequence ENSEMBL: ENSMUSP00000040217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039484]
Predicted Effect probably damaging
Transcript: ENSMUST00000039484
AA Change: S16C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040217
Gene: ENSMUSG00000039981
AA Change: S16C

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 91 247 4e-67 PFAM
low complexity region 333 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted regulation of excessive inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik A G 7: 104,059,005 I199T probably benign Het
6430628N08Rik A G 4: 115,898,294 T97A unknown Het
Adam23 T G 1: 63,563,336 probably null Het
Adamts8 C T 9: 30,954,491 T445I probably benign Het
Ahi1 T C 10: 20,988,625 V752A probably damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Bicra T C 7: 15,972,205 E1437G probably damaging Het
Cdc42ep4 C T 11: 113,729,172 S131N possibly damaging Het
Ces1f G A 8: 93,267,997 P262L probably benign Het
Chrna2 A T 14: 66,150,949 probably null Het
Cspg4 G A 9: 56,890,136 V1295M possibly damaging Het
D5Ertd579e T C 5: 36,615,756 T432A probably benign Het
Dach1 A T 14: 97,903,197 S456R probably damaging Het
Dhx37 T C 5: 125,422,167 D659G probably benign Het
Dscaml1 T C 9: 45,674,523 V586A probably damaging Het
Efhb G T 17: 53,463,168 L38I probably benign Het
Fam208b A T 13: 3,574,819 D1710E probably benign Het
Fbxw10 T C 11: 62,847,603 S108P possibly damaging Het
Fmnl2 A G 2: 53,097,332 N313S possibly damaging Het
Gga3 T C 11: 115,591,276 E172G probably damaging Het
Ggta1 A G 2: 35,402,722 V191A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hcn4 C T 9: 58,823,945 T145M unknown Het
Kirrel3 T C 9: 35,034,906 S654P probably damaging Het
Klrb1 A T 6: 128,710,523 probably null Het
Krt15 T A 11: 100,134,513 D166V probably damaging Het
Lipk T A 19: 34,040,394 Y277* probably null Het
Ly6g A C 15: 75,158,549 N49T possibly damaging Het
Ms4a4c A T 19: 11,414,827 Q4L probably benign Het
Nfya A C 17: 48,392,904 probably benign Het
Nub1 T C 5: 24,708,711 V530A probably benign Het
Ocln A T 13: 100,539,288 Y232* probably null Het
Olfr1129 A G 2: 87,575,513 N143S possibly damaging Het
Olfr1468-ps1 A G 19: 13,375,451 H163R unknown Het
Olfr456 A G 6: 42,487,013 F60S probably damaging Het
Olfr462 C T 11: 87,889,498 V133I probably benign Het
Otogl G A 10: 107,814,050 A1148V probably benign Het
Paqr5 C T 9: 61,972,831 W46* probably null Het
Psd2 C A 18: 35,980,332 L286M probably damaging Het
Ptpn4 A T 1: 119,684,581 Y27* probably null Het
Ripk2 A G 4: 16,158,275 probably null Het
Rsf1 G GACGGCGGCA 7: 97,579,909 probably benign Het
Sbk2 C T 7: 4,964,147 probably null Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sspo A C 6: 48,489,794 D4072A probably benign Het
St6galnac3 T C 3: 153,206,708 Y214C probably damaging Het
Sugp1 T A 8: 70,060,552 D256E possibly damaging Het
Sugt1 A G 14: 79,597,407 Y90C probably benign Het
Taok2 A G 7: 126,870,392 I1088T probably damaging Het
Tmc7 T A 7: 118,547,678 T459S probably benign Het
Tmed11 T C 5: 108,778,914 Y164C probably damaging Het
Tmem63b T C 17: 45,666,632 E356G probably benign Het
Ttc13 T C 8: 124,688,618 I261V probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn1r73 A T 7: 11,756,617 K121* probably null Het
Zfp292 A T 4: 34,807,812 M1744K probably damaging Het
Other mutations in Zc3h12d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zc3h12d APN 10 7862467 missense probably damaging 1.00
IGL01013:Zc3h12d APN 10 7839956 missense probably damaging 1.00
IGL02090:Zc3h12d APN 10 7867332 missense probably benign 0.00
IGL02876:Zc3h12d APN 10 7862600 missense probably damaging 0.99
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R1942:Zc3h12d UTSW 10 7853313 missense probably damaging 1.00
R2290:Zc3h12d UTSW 10 7867459 missense probably benign 0.00
R2354:Zc3h12d UTSW 10 7867938 missense probably benign 0.00
R4816:Zc3h12d UTSW 10 7867947 missense probably damaging 1.00
R4932:Zc3h12d UTSW 10 7853250 missense probably damaging 0.99
R5191:Zc3h12d UTSW 10 7867818 missense possibly damaging 0.51
R5384:Zc3h12d UTSW 10 7853250 missense probably damaging 1.00
R5396:Zc3h12d UTSW 10 7866326 missense probably damaging 1.00
R6409:Zc3h12d UTSW 10 7867318 missense probably benign 0.04
R6877:Zc3h12d UTSW 10 7839971 missense probably damaging 0.99
R6903:Zc3h12d UTSW 10 7867661 missense probably benign
R7312:Zc3h12d UTSW 10 7867581 missense probably benign 0.00
R7594:Zc3h12d UTSW 10 7862618 missense probably damaging 1.00
R7622:Zc3h12d UTSW 10 7867269 missense probably damaging 1.00
R7645:Zc3h12d UTSW 10 7867576 missense probably benign
R7769:Zc3h12d UTSW 10 7867626 missense probably benign 0.03
R7864:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
R7947:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
Z1177:Zc3h12d UTSW 10 7867808
Predicted Primers PCR Primer
(F):5'- CTGATAGATAACGCCACGAGGG -3'
(R):5'- CTGCCATCGATCACTATGGG -3'

Sequencing Primer
(F):5'- GTGCCCTTCTCACCCGGTAG -3'
(R):5'- ATCGATCACTATGGGCCGCAG -3'
Posted On2018-11-28