Incidental Mutation 'R0607:Cenpf'
ID54208
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
MMRRC Submission 038796-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R0607 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 189682463 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165663] [ENSMUST00000165962] [ENSMUST00000171929]
Predicted Effect probably benign
Transcript: ENSMUST00000165663
SMART Domains Protein: ENSMUSP00000130308
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 65 8.7e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165962
SMART Domains Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 7.3e-135 PFAM
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 379 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 572 592 N/A INTRINSIC
internal_repeat_1 737 759 3.18e-5 PROSPERO
internal_repeat_1 751 773 3.18e-5 PROSPERO
internal_repeat_2 789 804 5.94e-5 PROSPERO
coiled coil region 812 864 N/A INTRINSIC
coiled coil region 885 923 N/A INTRINSIC
low complexity region 925 936 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171929
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194165
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 147 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,554,698 E146G probably benign Het
4930435E12Rik A C 16: 38,828,364 S128A probably benign Het
Abca4 G A 3: 122,156,432 G594S probably damaging Het
Acacb T C 5: 114,200,301 Y726H probably damaging Het
Adam20 T A 8: 40,795,480 M209K probably benign Het
Adam29 A G 8: 55,873,275 V48A probably damaging Het
Adss A G 1: 177,767,687 V429A possibly damaging Het
Aff1 T C 5: 103,828,454 S481P probably damaging Het
Akr1c19 G A 13: 4,238,460 A146T probably benign Het
Ankhd1 G T 18: 36,640,280 V59F probably damaging Het
Ankmy1 T G 1: 92,888,675 Y239S probably damaging Het
Ankrd24 G T 10: 81,638,308 C19F probably damaging Het
Apaf1 T C 10: 91,009,203 H1002R probably damaging Het
Apc2 T C 10: 80,314,101 I1663T probably benign Het
Apcdd1 A G 18: 62,951,896 N388S possibly damaging Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Armc2 T A 10: 41,922,695 H706L probably benign Het
Arrb1 T C 7: 99,588,196 probably null Het
Atl3 T C 19: 7,529,666 probably null Het
B9d2 A G 7: 25,683,332 T44A probably damaging Het
Btbd3 C T 2: 138,283,816 R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 I343T probably benign Het
Cacna1a A G 8: 84,629,831 D1901G probably damaging Het
Ccdc42 C T 11: 68,597,710 Q312* probably null Het
Cdh18 T C 15: 23,410,790 Y454H probably benign Het
Celf5 G A 10: 81,466,005 T317I probably damaging Het
Celsr2 A T 3: 108,403,895 probably null Het
Cep350 T C 1: 155,872,048 D2042G probably damaging Het
Chd3 T C 11: 69,344,358 D2054G probably damaging Het
Chgb A G 2: 132,793,335 H399R probably benign Het
Clp1 C T 2: 84,725,591 A182T possibly damaging Het
Col15a1 A G 4: 47,282,654 N777S probably damaging Het
Coq6 A G 12: 84,368,638 D145G possibly damaging Het
Csf2rb2 T C 15: 78,287,908 Y325C probably benign Het
Ctnna2 T C 6: 76,902,430 T824A probably benign Het
Cyp4x1 T A 4: 115,112,826 D368V probably damaging Het
D10Wsu102e T C 10: 83,362,097 S56P probably benign Het
D430041D05Rik C T 2: 104,233,445 R1354H probably damaging Het
D6Ertd527e A C 6: 87,111,905 D350A unknown Het
Ddx24 A G 12: 103,419,067 Y426H possibly damaging Het
Dexi G T 16: 10,542,562 Y43* probably null Het
Dgka A G 10: 128,720,469 probably null Het
Dhx38 A T 8: 109,558,943 D419E probably benign Het
Dlg1 C A 16: 31,665,580 Q9K probably benign Het
Dlg1 G A 16: 31,838,174 V596I possibly damaging Het
Dnah11 A C 12: 118,082,511 W1731G probably damaging Het
Dnhd1 T A 7: 105,720,788 N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 S3152A probably benign Het
Egfl7 C T 2: 26,589,440 T68I probably damaging Het
Eif2a G A 3: 58,555,652 probably null Het
Emb G A 13: 117,232,750 V56I possibly damaging Het
Enpp4 A T 17: 44,099,495 C397S probably damaging Het
Entpd3 A G 9: 120,557,405 T151A possibly damaging Het
Ero1lb A G 13: 12,574,866 D50G probably damaging Het
Fam219a A G 4: 41,520,242 *169Q probably null Het
Fga G A 3: 83,028,562 G32E probably damaging Het
Fkbpl T C 17: 34,645,359 F34L probably benign Het
Fsd2 T A 7: 81,545,017 D466V probably damaging Het
Gja1 A G 10: 56,388,070 Y175C possibly damaging Het
Gm5478 T A 15: 101,644,624 I338F probably damaging Het
Greb1 T A 12: 16,682,193 Y1589F probably damaging Het
Grk3 C T 5: 112,920,053 E537K probably damaging Het
H2-K1 G T 17: 33,999,500 D127E probably damaging Het
Hcrtr2 A G 9: 76,230,684 L383P probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ikbke A T 1: 131,270,184 probably null Het
Il1r2 A G 1: 40,105,455 K101E probably benign Het
Itga11 A T 9: 62,774,371 H1054L probably benign Het
Kif13a A T 13: 46,802,711 V539D probably damaging Het
Kifc1 G A 17: 33,886,647 T62I probably damaging Het
Klhl28 A G 12: 64,951,755 Y322H probably damaging Het
Klhl6 C A 16: 19,957,014 D265Y possibly damaging Het
Krt86 T A 15: 101,479,531 C479S unknown Het
Lama2 C T 10: 27,189,131 R1179H probably benign Het
Lce6a A T 3: 92,620,328 H57Q probably benign Het
Lcn11 T C 2: 25,779,293 V154A probably benign Het
Lnpep A T 17: 17,538,554 F843I probably damaging Het
Lrrc49 C T 9: 60,666,357 V281I probably benign Het
Lrrtm1 C A 6: 77,244,628 A356E probably damaging Het
Map3k1 A C 13: 111,763,510 H493Q probably benign Het
Mcm4 A T 16: 15,632,115 probably null Het
Mdn1 C T 4: 32,712,014 P1844L probably damaging Het
Mdn1 T A 4: 32,732,829 D3076E probably benign Het
Med6 A T 12: 81,589,024 L27H probably damaging Het
Mkl2 A G 16: 13,381,601 E106G probably damaging Het
Myo7a T A 7: 98,071,946 T1271S probably damaging Het
Myo9a T A 9: 59,921,793 M2376K probably benign Het
Nell2 G A 15: 95,229,214 T760I probably benign Het
Neurod6 C T 6: 55,679,587 A22T probably benign Het
Nlrp10 T C 7: 108,924,285 K663E probably benign Het
Npr3 T A 15: 11,845,282 K501N probably benign Het
Nr2f2 C A 7: 70,354,712 R264L probably damaging Het
Nup35 T A 2: 80,642,640 M19K probably benign Het
Oacyl A T 18: 65,747,891 Q592L possibly damaging Het
Olfr1061 T A 2: 86,413,170 N294I probably damaging Het
Olfr1243 A G 2: 89,528,107 V101A possibly damaging Het
Olfr1378 C A 11: 50,969,843 A275D possibly damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1484 T A 19: 13,586,170 Y289N probably damaging Het
Olfr17 T A 7: 107,097,726 I87K probably benign Het
Olfr312 T A 11: 58,831,972 S273T probably damaging Het
Olfr470 A G 7: 107,845,569 S55P probably damaging Het
Olfr56 C G 11: 49,134,722 H177D probably damaging Het
Olfr813 T G 10: 129,857,201 S228A possibly damaging Het
Olfr827 T C 10: 130,211,070 E20G probably benign Het
Patl2 T C 2: 122,126,669 Y128C probably benign Het
Pcdhac2 A G 18: 37,145,889 I641V probably benign Het
Polr2b T C 5: 77,313,159 probably benign Het
Pot1b A T 17: 55,665,765 I469N probably damaging Het
Prdm11 G T 2: 93,013,785 D33E possibly damaging Het
Prkdc A G 16: 15,772,057 S2595G probably damaging Het
Prrc1 G A 18: 57,374,550 V259I possibly damaging Het
Prrc2b G T 2: 32,213,870 R1120L probably damaging Het
Prss38 T C 11: 59,375,543 S30G possibly damaging Het
Raph1 A T 1: 60,525,869 L153Q probably damaging Het
Reck A G 4: 43,940,719 T843A probably benign Het
Rgs7bp T C 13: 104,967,102 N164D probably benign Het
Rpusd4 C A 9: 35,267,993 A35D possibly damaging Het
Setd1b T C 5: 123,159,951 probably benign Het
Siglec15 G T 18: 78,046,137 D297E probably benign Het
Skint7 T A 4: 111,977,459 C13* probably null Het
Slc5a12 A G 2: 110,632,743 M395V probably benign Het
Sohlh2 C A 3: 55,207,683 S363Y probably damaging Het
Srgap3 A T 6: 112,723,119 V966E probably damaging Het
Stk4 C T 2: 164,098,542 P266L probably damaging Het
Stxbp5l G A 16: 37,142,432 H754Y probably benign Het
Synpo2l A T 14: 20,660,680 M624K probably damaging Het
Tas2r136 T C 6: 132,777,412 I251V probably benign Het
Tecpr1 C T 5: 144,212,590 V340M probably damaging Het
Tecta C T 9: 42,388,205 G196S probably damaging Het
Thsd7a T A 6: 12,331,542 probably null Het
Timeless T C 10: 128,246,334 V577A probably benign Het
Tln1 A T 4: 43,553,071 V340E probably damaging Het
Tmem132c T A 5: 127,563,553 Y929* probably null Het
Tmprss7 C T 16: 45,669,551 R436Q probably damaging Het
Tnik A C 3: 28,650,159 K989T probably damaging Het
Tnxb T A 17: 34,671,918 Y412N probably damaging Het
Trmt44 A G 5: 35,568,759 probably null Het
Trpm6 C A 19: 18,872,221 T1704N probably benign Het
Tsc2 A T 17: 24,621,712 V391E probably damaging Het
Ttc22 T C 4: 106,639,313 V520A possibly damaging Het
Ttc3 T A 16: 94,456,785 Y1650* probably null Het
Vmn2r24 A G 6: 123,786,934 T257A probably benign Het
Xab2 A C 8: 3,613,605 N408K probably benign Het
Zbtb42 A T 12: 112,680,627 Y412F probably benign Het
Zfp282 A G 6: 47,880,369 N179D probably damaging Het
Zfp62 C A 11: 49,215,400 T106K probably benign Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6834:Cenpf UTSW 1 189659446 missense probably damaging 1.00
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
R7353:Cenpf UTSW 1 189654138 nonsense probably null
R7402:Cenpf UTSW 1 189659378 nonsense probably null
R7460:Cenpf UTSW 1 189654050 missense probably damaging 0.97
R7484:Cenpf UTSW 1 189656821 missense probably damaging 1.00
R7574:Cenpf UTSW 1 189658667 missense probably damaging 1.00
R7691:Cenpf UTSW 1 189658207 nonsense probably null
R7698:Cenpf UTSW 1 189662072 missense probably benign 0.01
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTACCAAACGAGGGCTGGAG -3'
(R):5'- CAACAAGTTGCACAATCGGCAGATG -3'

Sequencing Primer
(F):5'- CAAACGAGGGCTGGAGTTTTTC -3'
(R):5'- GCACAATCGGCAGATGTTTCTC -3'
Posted On2013-07-11