Incidental Mutation 'R6968:Saxo2'
ID542108
Institutional Source Beutler Lab
Gene Symbol Saxo2
Ensembl Gene ENSMUSG00000038570
Gene Namestabilizer of axonemal microtubules 2
SynonymsFam154b, 1700129I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6968 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location82632960-82648528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82643761 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 43 (T43A)
Ref Sequence ENSEMBL: ENSMUSP00000057993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000056728] [ENSMUST00000126478] [ENSMUST00000141726] [ENSMUST00000179489] [ENSMUST00000207693]
Predicted Effect probably benign
Transcript: ENSMUST00000039881
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056728
AA Change: T43A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057993
Gene: ENSMUSG00000038570
AA Change: T43A

DomainStartEndE-ValueType
Pfam:STOP 4 201 3.6e-42 PFAM
Pfam:STOP 237 390 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126478
Predicted Effect probably benign
Transcript: ENSMUST00000141726
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179489
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207693
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Saxo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Saxo2 APN 7 82648405 missense probably benign 0.43
IGL01992:Saxo2 APN 7 82634900 missense probably damaging 0.97
R0973:Saxo2 UTSW 7 82634870 missense probably benign 0.00
R0973:Saxo2 UTSW 7 82634870 missense probably benign 0.00
R0974:Saxo2 UTSW 7 82634870 missense probably benign 0.00
R1169:Saxo2 UTSW 7 82635171 missense possibly damaging 0.77
R3113:Saxo2 UTSW 7 82643741 missense probably benign 0.05
R4912:Saxo2 UTSW 7 82634535 missense probably benign 0.00
R5406:Saxo2 UTSW 7 82635378 missense probably benign
R5784:Saxo2 UTSW 7 82634874 missense probably benign 0.01
R6344:Saxo2 UTSW 7 82634865 missense probably damaging 0.96
R6677:Saxo2 UTSW 7 82635276 missense probably benign 0.01
R6806:Saxo2 UTSW 7 82635032 missense probably benign 0.00
R6912:Saxo2 UTSW 7 82635194 missense possibly damaging 0.89
R7621:Saxo2 UTSW 7 82648417 missense possibly damaging 0.67
R7655:Saxo2 UTSW 7 82635351 missense probably damaging 1.00
R7656:Saxo2 UTSW 7 82635351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCACTGTGGCTAAGTATGAC -3'
(R):5'- GGCTTTTGGAAAAGTGACTACAAAGC -3'

Sequencing Primer
(F):5'- CCACTGTGGCTAAGTATGACAATAC -3'
(R):5'- TCACTTAAGATCAAATTGAAGAGCTG -3'
Posted On2018-11-28