Incidental Mutation 'R6968:Zfp39'
ID542124
Institutional Source Beutler Lab
Gene Symbol Zfp39
Ensembl Gene ENSMUSG00000037001
Gene Namezinc finger protein 39
SynonymsZfp-39, CTfin33
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6968 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58888153-58904225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58891480 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 152 (H152R)
Ref Sequence ENSEMBL: ENSMUSP00000099764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102703]
Predicted Effect probably benign
Transcript: ENSMUST00000102703
AA Change: H152R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099764
Gene: ENSMUSG00000037001
AA Change: H152R

DomainStartEndE-ValueType
KRAB 59 119 8.23e-34 SMART
low complexity region 171 180 N/A INTRINSIC
ZnF_C2H2 298 320 9.58e-3 SMART
ZnF_C2H2 326 347 2.2e2 SMART
ZnF_C2H2 353 373 1.18e2 SMART
ZnF_C2H2 409 431 8.34e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
ZnF_C2H2 465 487 1.53e-1 SMART
ZnF_C2H2 493 515 9.08e-4 SMART
ZnF_C2H2 521 543 2.61e-4 SMART
ZnF_C2H2 549 571 1.12e-3 SMART
ZnF_C2H2 577 599 4.94e-5 SMART
ZnF_C2H2 605 627 5.14e-3 SMART
ZnF_C2H2 633 655 1.38e-3 SMART
ZnF_C2H2 661 683 6.78e-3 SMART
ZnF_C2H2 689 711 5.14e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Kruppel-associated box (KRAB) zinc-finger protein, which belongs to a large group of transcriptional regulators in mammals. These proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation and apoptosis, and in regulating viral replication and transcription. A pseudogene of this gene was identified on chromosome 1. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Jag2 C T 12: 112,914,258 E592K probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Zfp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Zfp39 APN 11 58893059 splice site probably benign
IGL01597:Zfp39 APN 11 58891543 missense probably damaging 0.96
IGL02055:Zfp39 APN 11 58891330 missense probably benign
IGL02456:Zfp39 APN 11 58902800 nonsense probably null
IGL02873:Zfp39 APN 11 58891022 missense probably benign 0.12
H8562:Zfp39 UTSW 11 58900686 missense probably damaging 1.00
R0462:Zfp39 UTSW 11 58890406 missense probably benign 0.03
R0513:Zfp39 UTSW 11 58889987 missense probably benign 0.09
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1185:Zfp39 UTSW 11 58902844 missense possibly damaging 0.91
R1401:Zfp39 UTSW 11 58890323 missense probably benign 0.01
R1797:Zfp39 UTSW 11 58900660 missense probably damaging 0.96
R2146:Zfp39 UTSW 11 58890332 missense probably benign 0.05
R3903:Zfp39 UTSW 11 58890175 missense probably benign 0.44
R4303:Zfp39 UTSW 11 58890017 missense probably damaging 1.00
R4706:Zfp39 UTSW 11 58902807 missense probably benign 0.41
R4957:Zfp39 UTSW 11 58891231 missense possibly damaging 0.63
R5092:Zfp39 UTSW 11 58891202 missense possibly damaging 0.71
R5158:Zfp39 UTSW 11 58889845 missense possibly damaging 0.81
R5292:Zfp39 UTSW 11 58900589 missense probably damaging 0.97
R5697:Zfp39 UTSW 11 58889835 missense probably benign 0.08
R5906:Zfp39 UTSW 11 58902891 missense probably benign
R5925:Zfp39 UTSW 11 58891273 missense possibly damaging 0.94
R6174:Zfp39 UTSW 11 58891387 missense probably benign 0.01
R6177:Zfp39 UTSW 11 58891061 missense probably benign 0.27
R7045:Zfp39 UTSW 11 58890443 missense unknown
R7139:Zfp39 UTSW 11 58890559 missense probably damaging 1.00
R7421:Zfp39 UTSW 11 58890107 missense probably damaging 1.00
R7493:Zfp39 UTSW 11 58891043 missense possibly damaging 0.82
R7689:Zfp39 UTSW 11 58890643 missense probably damaging 1.00
R8061:Zfp39 UTSW 11 58902747 missense probably benign
R8136:Zfp39 UTSW 11 58891402 missense probably damaging 0.99
R8955:Zfp39 UTSW 11 58890120 nonsense probably null
Z1186:Zfp39 UTSW 11 58890045 nonsense probably null
Z1186:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1186:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1186:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1186:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1186:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1186:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1186:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1186:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1186:Zfp39 UTSW 11 58891297 missense probably benign
Z1186:Zfp39 UTSW 11 58891316 missense probably benign
Z1186:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1186:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890045 nonsense probably null
Z1187:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1187:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1187:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1187:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1187:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1187:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1187:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1187:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1187:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1187:Zfp39 UTSW 11 58891297 missense probably benign
Z1187:Zfp39 UTSW 11 58891316 missense probably benign
Z1187:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1187:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890045 nonsense probably null
Z1188:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1188:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1188:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1188:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1188:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1188:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1188:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1188:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1188:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1188:Zfp39 UTSW 11 58891297 missense probably benign
Z1188:Zfp39 UTSW 11 58891316 missense probably benign
Z1188:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1188:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890045 nonsense probably null
Z1189:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1189:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1189:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1189:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1189:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1189:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1189:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1189:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1189:Zfp39 UTSW 11 58891297 missense probably benign
Z1189:Zfp39 UTSW 11 58891316 missense probably benign
Z1189:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1189:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890045 nonsense probably null
Z1190:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1190:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1190:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1190:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1190:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1190:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1190:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1190:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1190:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1190:Zfp39 UTSW 11 58891297 missense probably benign
Z1190:Zfp39 UTSW 11 58891316 missense probably benign
Z1190:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1190:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890045 nonsense probably null
Z1191:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1191:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1191:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1191:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1191:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1191:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1191:Zfp39 UTSW 11 58890876 missense probably damaging 0.97
Z1191:Zfp39 UTSW 11 58890886 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1191:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1191:Zfp39 UTSW 11 58891297 missense probably benign
Z1191:Zfp39 UTSW 11 58891316 missense probably benign
Z1191:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1191:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890045 nonsense probably null
Z1192:Zfp39 UTSW 11 58890047 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890304 missense possibly damaging 0.91
Z1192:Zfp39 UTSW 11 58890447 missense probably benign 0.16
Z1192:Zfp39 UTSW 11 58890448 missense possibly damaging 0.86
Z1192:Zfp39 UTSW 11 58890700 missense possibly damaging 0.50
Z1192:Zfp39 UTSW 11 58890771 missense probably benign 0.00
Z1192:Zfp39 UTSW 11 58890779 missense probably benign 0.09
Z1192:Zfp39 UTSW 11 58890898 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58890925 missense probably benign 0.29
Z1192:Zfp39 UTSW 11 58891141 missense probably damaging 0.99
Z1192:Zfp39 UTSW 11 58891297 missense probably benign
Z1192:Zfp39 UTSW 11 58891316 missense probably benign
Z1192:Zfp39 UTSW 11 58900581 missense probably benign 0.01
Z1192:Zfp39 UTSW 11 58900583 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAATCCTCGTGTCATCGG -3'
(R):5'- GTAAACTCTACGTTACAGATCCACTG -3'

Sequencing Primer
(F):5'- AATCCTCGTGTCATCGGGCTTG -3'
(R):5'- GATCCACTGGAGACACACAC -3'
Posted On2018-11-28