Incidental Mutation 'R6968:Jag2'
ID542134
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Namejagged 2
SynonymsSerh, D12Ggc2e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6968 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112907819-112929776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112914258 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 592 (E592K)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
Predicted Effect probably benign
Transcript: ENSMUST00000075827
AA Change: E592K

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: E592K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apip C T 2: 103,089,453 L125F possibly damaging Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Arhgef5 T C 6: 43,275,342 V1009A probably benign Het
Armc4 T C 18: 7,273,155 probably null Het
Asah2 A T 19: 32,012,513 I489K probably benign Het
Bace1 A G 9: 45,854,965 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Ccdc162 T C 10: 41,673,844 T348A possibly damaging Het
Cdkn2aip C A 8: 47,713,887 probably benign Het
Cep78 A C 19: 15,981,738 F111V probably benign Het
Chd4 T A 6: 125,108,318 L784Q probably damaging Het
Chrna6 C T 8: 27,406,655 C398Y probably benign Het
Cmip T C 8: 117,377,156 Y128H probably damaging Het
Cpne2 C T 8: 94,548,502 P46L probably damaging Het
Cyp2w1 A G 5: 139,353,991 Q112R probably damaging Het
Entpd3 A T 9: 120,560,656 E336V probably benign Het
Fbxw28 A C 9: 109,330,788 S197A probably benign Het
Foxk2 T C 11: 121,260,482 F118L possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Hinfp A C 9: 44,297,985 S306A probably benign Het
Hspg2 T A 4: 137,535,156 V1663E probably damaging Het
Inpp4b T C 8: 81,844,457 I125T probably benign Het
Krt23 T A 11: 99,481,074 E317V probably damaging Het
Ltbp2 C T 12: 84,789,083 probably null Het
Mast4 G T 13: 102,798,078 N152K probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mier2 G A 10: 79,540,642 probably benign Het
Mmp9 A G 2: 164,952,940 T584A probably benign Het
Necab1 T C 4: 14,957,852 E335G probably damaging Het
Nlrp9b T A 7: 20,049,508 N925K probably damaging Het
Nr4a2 T C 2: 57,108,746 probably null Het
Nrg2 T C 18: 36,196,446 I239V probably benign Het
Nsun2 A G 13: 69,631,290 D562G probably benign Het
Olfr391-ps A G 11: 73,799,379 I126T possibly damaging Het
Ormdl3 T A 11: 98,584,115 M1L probably benign Het
Pcdh10 T A 3: 45,379,542 V97D probably damaging Het
Pde3a T C 6: 141,487,932 F847L probably damaging Het
Ppp1r13b C A 12: 111,833,178 V722F possibly damaging Het
Rhoh A G 5: 65,892,519 D44G possibly damaging Het
Riox1 C T 12: 83,951,373 R228C probably damaging Het
Rtl1 C T 12: 109,594,679 R242Q unknown Het
Saxo2 T C 7: 82,643,761 T43A probably damaging Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Sema3f C T 9: 107,691,449 probably null Het
Snap25 T C 2: 136,769,770 M64T probably benign Het
Spef2 T C 15: 9,597,340 N1410S probably benign Het
Sstr2 T C 11: 113,624,948 I231T probably damaging Het
Stam A T 2: 14,116,018 H78L probably damaging Het
Suox C T 10: 128,671,833 V109I possibly damaging Het
Syne1 T C 10: 5,117,041 R7075G probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tln1 C T 4: 43,550,217 R482Q probably benign Het
Tnrc6a T C 7: 123,182,427 V1440A probably benign Het
Togaram2 A G 17: 71,709,613 D655G probably damaging Het
Trgv2 A T 13: 19,336,726 I66K probably damaging Het
Vmn1r113 A T 7: 20,787,951 I223F probably damaging Het
Vmn2r62 T A 7: 42,788,442 H206L probably benign Het
Zan T A 5: 137,461,813 Y1272F unknown Het
Zfp39 T C 11: 58,891,480 H152R probably benign Het
Zfp41 T A 15: 75,618,461 Y87* probably null Het
Zfp933 A T 4: 147,826,197 L314H probably damaging Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R0963:Jag2 UTSW 12 112915314 missense probably damaging 1.00
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112916319 unclassified probably benign
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5242:Jag2 UTSW 12 112916866 missense probably damaging 0.97
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7663:Jag2 UTSW 12 112913666 missense probably damaging 1.00
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
R8075:Jag2 UTSW 12 112915274 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTCGTCAATGTCTGAGGGAG -3'
(R):5'- CTTGAGGGTGACTACTACTGCG -3'

Sequencing Primer
(F):5'- AGGATGGGTGAGCTGTCCC -3'
(R):5'- GCCTGCCCAGAAGACTTTG -3'
Posted On2018-11-28