Mutagenetix > Incidental Mutation

Incidental Mutation 'R6968:Golm1'

542136

Institutional Source

Beutler Lab

Gene Symbol

Golm1

Ensembl Gene

ENSMUSG00000021556

Gene Name

golgi membrane protein 1

Synonyms

2310001L02Rik, GP73, PSEC0257, D030064E01Rik, Golph2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R6968 (G1)

Quality Score

217.468

Status

Validated

Chromosome

Chromosomal Location

59634626-59675811 bp(-) (GRCm38)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

ACTTCTTCT to ACTTCT at 59649576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000093410 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022039] [ENSMUST00000095739]

AlphaFold

Q91XA2

Predicted Effect

probably benign
Transcript: ENSMUST00000022039

SMART Domains

Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
coiled coil region	40	144	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095739

SMART Domains

Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
coiled coil region	40	144	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.1%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apip	C	T	2: 103,089,453	L125F	possibly damaging	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Arhgef5	T	C	6: 43,275,342	V1009A	probably benign	Het
Armc4	T	C	18: 7,273,155		probably null	Het
Asah2	A	T	19: 32,012,513	I489K	probably benign	Het
Bace1	A	G	9: 45,854,965		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Ccdc162	T	C	10: 41,673,844	T348A	possibly damaging	Het
Cdkn2aip	C	A	8: 47,713,887		probably benign	Het
Cep78	A	C	19: 15,981,738	F111V	probably benign	Het
Chd4	T	A	6: 125,108,318	L784Q	probably damaging	Het
Chrna6	C	T	8: 27,406,655	C398Y	probably benign	Het
Cmip	T	C	8: 117,377,156	Y128H	probably damaging	Het
Cpne2	C	T	8: 94,548,502	P46L	probably damaging	Het
Cyp2w1	A	G	5: 139,353,991	Q112R	probably damaging	Het
Entpd3	A	T	9: 120,560,656	E336V	probably benign	Het
Fbxw28	A	C	9: 109,330,788	S197A	probably benign	Het
Foxk2	T	C	11: 121,260,482	F118L	possibly damaging	Het
Hinfp	A	C	9: 44,297,985	S306A	probably benign	Het
Hspg2	T	A	4: 137,535,156	V1663E	probably damaging	Het
Inpp4b	T	C	8: 81,844,457	I125T	probably benign	Het
Jag2	C	T	12: 112,914,258	E592K	probably benign	Het
Krt23	T	A	11: 99,481,074	E317V	probably damaging	Het
Ltbp2	C	T	12: 84,789,083		probably null	Het
Mast4	G	T	13: 102,798,078	N152K	probably damaging	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mier2	G	A	10: 79,540,642		probably benign	Het
Mmp9	A	G	2: 164,952,940	T584A	probably benign	Het
Necab1	T	C	4: 14,957,852	E335G	probably damaging	Het
Nlrp9b	T	A	7: 20,049,508	N925K	probably damaging	Het
Nr4a2	T	C	2: 57,108,746		probably null	Het
Nrg2	T	C	18: 36,196,446	I239V	probably benign	Het
Nsun2	A	G	13: 69,631,290	D562G	probably benign	Het
Olfr391-ps	A	G	11: 73,799,379	I126T	possibly damaging	Het
Ormdl3	T	A	11: 98,584,115	M1L	probably benign	Het
Pcdh10	T	A	3: 45,379,542	V97D	probably damaging	Het
Pde3a	T	C	6: 141,487,932	F847L	probably damaging	Het
Ppp1r13b	C	A	12: 111,833,178	V722F	possibly damaging	Het
Rhoh	A	G	5: 65,892,519	D44G	possibly damaging	Het
Riox1	C	T	12: 83,951,373	R228C	probably damaging	Het
Rtl1	C	T	12: 109,594,679	R242Q	unknown	Het
Saxo2	T	C	7: 82,643,761	T43A	probably damaging	Het
Sec16a	G	A	2: 26,430,486	R1361C	probably damaging	Het
Sema3f	C	T	9: 107,691,449		probably null	Het
Snap25	T	C	2: 136,769,770	M64T	probably benign	Het
Spef2	T	C	15: 9,597,340	N1410S	probably benign	Het
Sstr2	T	C	11: 113,624,948	I231T	probably damaging	Het
Stam	A	T	2: 14,116,018	H78L	probably damaging	Het
Suox	C	T	10: 128,671,833	V109I	possibly damaging	Het
Syne1	T	C	10: 5,117,041	R7075G	probably benign	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tln1	C	T	4: 43,550,217	R482Q	probably benign	Het
Tnrc6a	T	C	7: 123,182,427	V1440A	probably benign	Het
Togaram2	A	G	17: 71,709,613	D655G	probably damaging	Het
Trgv2	A	T	13: 19,336,726	I66K	probably damaging	Het
Vmn1r113	A	T	7: 20,787,951	I223F	probably damaging	Het
Vmn2r62	T	A	7: 42,788,442	H206L	probably benign	Het
Zan	T	A	5: 137,461,813	Y1272F	unknown	Het
Zfp39	T	C	11: 58,891,480	H152R	probably benign	Het
Zfp41	T	A	15: 75,618,461	Y87*	probably null	Het
Zfp933	A	T	4: 147,826,197	L314H	probably damaging	Het

Other mutations in Golm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01116:Golm1	APN	13	59649656	missense	probably damaging	0.99
IGL01327:Golm1	APN	13	59645144	missense	possibly damaging	0.95
IGL02348:Golm1	APN	13	59638377	missense	probably benign	0.00
R0047:Golm1	UTSW	13	59645100	missense	probably benign	0.03
R0047:Golm1	UTSW	13	59645100	missense	probably benign	0.03
R0458:Golm1	UTSW	13	59664364	missense	probably damaging	0.98
R0989:Golm1	UTSW	13	59640183	missense	probably benign	0.01
R1301:Golm1	UTSW	13	59638373	missense	probably damaging	0.99
R1804:Golm1	UTSW	13	59642389	critical splice acceptor site	probably null
R1905:Golm1	UTSW	13	59642251	missense	probably benign	0.04
R1940:Golm1	UTSW	13	59642237	splice site	probably benign
R2086:Golm1	UTSW	13	59645185	nonsense	probably null
R2513:Golm1	UTSW	13	59642258	missense	probably benign	0.01
R2887:Golm1	UTSW	13	59640230	missense	probably benign	0.00
R3903:Golm1	UTSW	13	59638340	missense	probably damaging	1.00
R4154:Golm1	UTSW	13	59642353	missense	probably benign	0.01
R5580:Golm1	UTSW	13	59642365	missense	probably benign	0.03
R6193:Golm1	UTSW	13	59645158	missense	probably benign	0.00
R6418:Golm1	UTSW	13	59665561	missense	probably damaging	1.00
R6594:Golm1	UTSW	13	59664227	missense	possibly damaging	0.79
R6604:Golm1	UTSW	13	59638383	missense	probably damaging	1.00
R6967:Golm1	UTSW	13	59649576	small deletion	probably benign
R6991:Golm1	UTSW	13	59649576	small deletion	probably benign
R6992:Golm1	UTSW	13	59649576	small deletion	probably benign
R6993:Golm1	UTSW	13	59649576	small deletion	probably benign
R6996:Golm1	UTSW	13	59642244	missense	probably benign	0.00
R7576:Golm1	UTSW	13	59645106	missense	probably benign	0.00
R7692:Golm1	UTSW	13	59640257	missense	probably benign	0.08
R7863:Golm1	UTSW	13	59649569	missense	probably damaging	1.00
R7948:Golm1	UTSW	13	59664197	critical splice donor site	probably null
R9519:Golm1	UTSW	13	59645100	missense	probably benign
R9703:Golm1	UTSW	13	59649619	missense	probably benign	0.39
X0026:Golm1	UTSW	13	59638313	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCATGTGAACATATGCATGC -3'
(R):5'- TCAAGGTGCAGGCTTCTGTG -3'

Sequencing Primer
(F):5'- CCATGTGAACATATGCATGCATGTAC -3'
(R):5'- TCTGTAGACCGGACTAGGTTCAAC -3'

Posted On

2018-11-28