Incidental Mutation 'R6970:Arfgef1'
ID542146
Institutional Source Beutler Lab
Gene Symbol Arfgef1
Ensembl Gene ENSMUSG00000067851
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
SynonymsP200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6970 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location10137571-10232670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10153678 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1465 (Q1465R)
Ref Sequence ENSEMBL: ENSMUSP00000085986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088615]
Predicted Effect probably damaging
Transcript: ENSMUST00000088615
AA Change: Q1465R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: Q1465R

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Meta Mutation Damage Score 0.3089 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Arfgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arfgef1 APN 1 10199787 missense probably benign
IGL00919:Arfgef1 APN 1 10173237 missense probably damaging 1.00
IGL01022:Arfgef1 APN 1 10174076 missense probably damaging 1.00
IGL01155:Arfgef1 APN 1 10198982 splice site probably benign
IGL01288:Arfgef1 APN 1 10213211 missense possibly damaging 0.67
IGL01397:Arfgef1 APN 1 10159571 missense probably benign 0.40
IGL01433:Arfgef1 APN 1 10153432 missense probably damaging 1.00
IGL01653:Arfgef1 APN 1 10159908 nonsense probably null
IGL01669:Arfgef1 APN 1 10159615 missense probably damaging 1.00
IGL01795:Arfgef1 APN 1 10147528 missense probably benign 0.01
IGL01860:Arfgef1 APN 1 10154396 missense probably damaging 1.00
IGL02137:Arfgef1 APN 1 10213113 missense probably damaging 1.00
IGL02365:Arfgef1 APN 1 10199883 missense probably benign 0.00
IGL02519:Arfgef1 APN 1 10209668 missense probably benign 0.13
IGL02542:Arfgef1 APN 1 10172842 missense probably benign 0.24
IGL02604:Arfgef1 APN 1 10181050 splice site probably benign
IGL02743:Arfgef1 APN 1 10199829 missense probably benign 0.00
IGL03225:Arfgef1 APN 1 10154318 missense probably damaging 1.00
Collected UTSW 1 10180938 missense probably damaging 1.00
uncle_joe UTSW 1 10160835 missense probably damaging 1.00
I2288:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
I2289:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
R0383:Arfgef1 UTSW 1 10198842 critical splice donor site probably null
R0491:Arfgef1 UTSW 1 10179987 splice site probably benign
R0636:Arfgef1 UTSW 1 10199851 missense probably benign
R1006:Arfgef1 UTSW 1 10140481 missense probably benign 0.00
R1212:Arfgef1 UTSW 1 10216559 missense probably benign 0.05
R1233:Arfgef1 UTSW 1 10184090 missense probably damaging 1.00
R1346:Arfgef1 UTSW 1 10159733 missense probably benign 0.41
R1416:Arfgef1 UTSW 1 10172939 missense probably damaging 1.00
R1477:Arfgef1 UTSW 1 10189284 missense probably damaging 1.00
R1581:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1587:Arfgef1 UTSW 1 10159959 missense probably damaging 0.99
R1602:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1745:Arfgef1 UTSW 1 10173255 missense probably damaging 1.00
R1831:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1832:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1833:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1918:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1919:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2059:Arfgef1 UTSW 1 10188752 splice site probably null
R2146:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2148:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2149:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2150:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2373:Arfgef1 UTSW 1 10174142 missense probably damaging 1.00
R2516:Arfgef1 UTSW 1 10153654 missense possibly damaging 0.89
R3863:Arfgef1 UTSW 1 10142586 frame shift probably null
R3916:Arfgef1 UTSW 1 10189443 missense probably benign 0.01
R3948:Arfgef1 UTSW 1 10142586 frame shift probably null
R3949:Arfgef1 UTSW 1 10142586 frame shift probably null
R3977:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3978:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3979:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R4086:Arfgef1 UTSW 1 10163759 missense probably benign 0.06
R4175:Arfgef1 UTSW 1 10159636 missense probably damaging 1.00
R4257:Arfgef1 UTSW 1 10159546 intron probably benign
R4572:Arfgef1 UTSW 1 10213141 missense probably damaging 1.00
R4652:Arfgef1 UTSW 1 10173262 missense probably damaging 0.98
R4678:Arfgef1 UTSW 1 10142666 missense probably benign 0.03
R4737:Arfgef1 UTSW 1 10189611 missense possibly damaging 0.85
R4779:Arfgef1 UTSW 1 10153733 missense probably damaging 1.00
R4818:Arfgef1 UTSW 1 10216547 missense probably benign
R4898:Arfgef1 UTSW 1 10159573 missense possibly damaging 0.75
R4979:Arfgef1 UTSW 1 10213109 missense probably damaging 1.00
R5039:Arfgef1 UTSW 1 10199736 missense probably benign 0.37
R5194:Arfgef1 UTSW 1 10204907 missense probably benign 0.09
R5428:Arfgef1 UTSW 1 10160835 missense probably damaging 1.00
R5533:Arfgef1 UTSW 1 10199727 critical splice donor site probably null
R5547:Arfgef1 UTSW 1 10160976 missense probably damaging 1.00
R5562:Arfgef1 UTSW 1 10144746 missense probably damaging 1.00
R5635:Arfgef1 UTSW 1 10188860 missense possibly damaging 0.81
R5697:Arfgef1 UTSW 1 10160838 missense probably benign 0.03
R5704:Arfgef1 UTSW 1 10159583 missense probably damaging 0.98
R5722:Arfgef1 UTSW 1 10138884 missense probably benign 0.04
R5793:Arfgef1 UTSW 1 10209528 missense probably benign 0.01
R5835:Arfgef1 UTSW 1 10160739 missense probably damaging 1.00
R5870:Arfgef1 UTSW 1 10180938 missense probably damaging 1.00
R5990:Arfgef1 UTSW 1 10172921 missense probably damaging 0.99
R6290:Arfgef1 UTSW 1 10188811 missense possibly damaging 0.91
R6460:Arfgef1 UTSW 1 10213060 missense probably damaging 1.00
R6613:Arfgef1 UTSW 1 10194396 missense possibly damaging 0.95
R6802:Arfgef1 UTSW 1 10189452 missense probably benign 0.35
R6967:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6967:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6968:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6968:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6969:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6969:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6970:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R7092:Arfgef1 UTSW 1 10153676 missense probably damaging 1.00
R7251:Arfgef1 UTSW 1 10198975 missense possibly damaging 0.81
R7334:Arfgef1 UTSW 1 10184460 missense probably damaging 1.00
R7399:Arfgef1 UTSW 1 10180897 missense probably benign 0.00
R7631:Arfgef1 UTSW 1 10232469 missense probably benign 0.00
R7699:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7700:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7772:Arfgef1 UTSW 1 10157010 missense possibly damaging 0.96
V1662:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTGCTAACTGCTCATTGTC -3'
(R):5'- ACTTATAGTTCAGGCTCTGTGGC -3'

Sequencing Primer
(F):5'- GCTAACTGCTCATTGTCTAGAAAAG -3'
(R):5'- AGAGAGGCTCGTTTTTCCTC -3'
Posted On2018-11-28