Incidental Mutation 'R6970:BC034090'
ID542151
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene NamecDNA sequence BC034090
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6970 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location155212471-155244444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155241439 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 311 (D311V)
Ref Sequence ENSEMBL: ENSMUSP00000139623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186156]
Predicted Effect probably damaging
Transcript: ENSMUST00000186156
AA Change: D311V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: D311V

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155225447 missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155225451 nonsense probably null
IGL00481:BC034090 APN 1 155232521 missense probably benign 0.04
IGL01309:BC034090 APN 1 155226384 missense probably damaging 0.98
IGL01813:BC034090 APN 1 155226339 nonsense probably null
IGL01938:BC034090 APN 1 155232592 splice site probably null
IGL01982:BC034090 APN 1 155223332 missense probably damaging 1.00
IGL02115:BC034090 APN 1 155232651 intron probably benign
IGL02338:BC034090 APN 1 155217471 missense probably damaging 1.00
IGL02406:BC034090 APN 1 155225153 missense probably benign 0.00
IGL03243:BC034090 APN 1 155225655 missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155226110 missense probably damaging 1.00
R0055:BC034090 UTSW 1 155241658 missense probably damaging 1.00
R1436:BC034090 UTSW 1 155225916 missense probably benign 0.04
R1649:BC034090 UTSW 1 155225573 missense possibly damaging 0.72
R1710:BC034090 UTSW 1 155225864 missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155225829 missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155225226 missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155221594 unclassified probably benign
R2012:BC034090 UTSW 1 155221432 missense probably damaging 0.98
R2133:BC034090 UTSW 1 155225786 missense probably benign 0.27
R3426:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3427:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3428:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3782:BC034090 UTSW 1 155226278 missense probably damaging 1.00
R3792:BC034090 UTSW 1 155241797 missense probably damaging 0.98
R4234:BC034090 UTSW 1 155241580 missense probably benign
R4373:BC034090 UTSW 1 155226158 missense probably benign 0.22
R4377:BC034090 UTSW 1 155232450 missense probably benign 0.00
R4661:BC034090 UTSW 1 155232475 missense probably damaging 0.98
R4676:BC034090 UTSW 1 155226264 missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155225090 missense probably damaging 1.00
R5170:BC034090 UTSW 1 155213650 missense probably damaging 1.00
R5340:BC034090 UTSW 1 155226414 missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155225603 missense probably benign 0.09
R5384:BC034090 UTSW 1 155242027 missense possibly damaging 0.68
R5576:BC034090 UTSW 1 155241468 missense probably benign 0.01
R5891:BC034090 UTSW 1 155233047 unclassified probably benign
R6060:BC034090 UTSW 1 155241499 missense probably benign 0.00
R6092:BC034090 UTSW 1 155224913 missense probably damaging 0.99
R6662:BC034090 UTSW 1 155226339 missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155241930 missense possibly damaging 0.92
R6903:BC034090 UTSW 1 155221385 missense probably benign 0.03
R7144:BC034090 UTSW 1 155242031 missense probably damaging 1.00
R7201:BC034090 UTSW 1 155241934 missense probably damaging 0.98
R7265:BC034090 UTSW 1 155225327 missense probably damaging 0.96
R7380:BC034090 UTSW 1 155232483 missense probably damaging 1.00
R7436:BC034090 UTSW 1 155226381 missense probably damaging 1.00
R7569:BC034090 UTSW 1 155217405 missense probably benign 0.00
R7587:BC034090 UTSW 1 155217486 missense probably damaging 1.00
R7664:BC034090 UTSW 1 155241631 missense probably damaging 1.00
X0002:BC034090 UTSW 1 155226279 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATAGCCTCTGTCCCTAAGC -3'
(R):5'- TTGATCCCTAGAACAGACCAGC -3'

Sequencing Primer
(F):5'- GAATAGCCTCCCACTGACCTGG -3'
(R):5'- TAGAACAGACCAGCCAGAGACATTC -3'
Posted On2018-11-28