Incidental Mutation 'R6970:Adcy10'
ID 542152
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 045080-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R6970 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 165384485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1082 (N1082S)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: N1082S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: N1082S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: N1082S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: N1082S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: N1082S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: N1082S

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb T C 7: 131,036,044 (GRCm39) Y285H possibly damaging Het
Adam17 A G 12: 21,395,669 (GRCm39) S285P probably benign Het
Ahdc1 T A 4: 132,789,656 (GRCm39) L299Q possibly damaging Het
Ambra1 T A 2: 91,602,945 (GRCm39) probably benign Het
Arfgef1 T C 1: 10,223,903 (GRCm39) Q1465R probably damaging Het
Arfgef1 G T 1: 10,223,904 (GRCm39) Q1465K probably damaging Het
Atp8a1 A G 5: 67,895,805 (GRCm39) V543A probably damaging Het
BC034090 T A 1: 155,117,185 (GRCm39) D311V probably damaging Het
Blnk G T 19: 40,950,821 (GRCm39) P110Q probably damaging Het
Cc2d2a A G 5: 43,875,927 (GRCm39) E968G probably damaging Het
Ccdc14 A T 16: 34,529,903 (GRCm39) E394V probably damaging Het
Ccdc162 A T 10: 41,491,954 (GRCm39) H1086Q probably benign Het
Ccdc85b T A 19: 5,507,248 (GRCm39) I60F probably damaging Het
Ceacam20 T A 7: 19,723,902 (GRCm39) L562Q probably damaging Het
Cntrl T C 2: 35,008,149 (GRCm39) F188L probably benign Het
Cplane1 T C 15: 8,217,032 (GRCm39) V750A probably benign Het
Dclk1 A T 3: 55,374,022 (GRCm39) probably benign Het
Ddx20 A T 3: 105,587,674 (GRCm39) L434H probably damaging Het
Ddx51 G A 5: 110,804,728 (GRCm39) V547M probably damaging Het
Dnah11 T A 12: 118,072,679 (GRCm39) Q1472L probably benign Het
Dnajb13 T C 7: 100,156,629 (GRCm39) E149G probably damaging Het
Efcab3 A G 11: 104,667,182 (GRCm39) E1422G probably benign Het
Eif1ad8 G T 12: 87,563,388 (GRCm39) probably benign Het
Fat4 A G 3: 39,035,924 (GRCm39) N3192S probably damaging Het
Fat4 A T 3: 39,050,120 (GRCm39) D3994V probably damaging Het
Fcgr1 C A 3: 96,191,936 (GRCm39) probably null Het
Gm12185 G A 11: 48,798,739 (GRCm39) R585* probably null Het
Gm32687 A G 10: 81,715,304 (GRCm39) H232R probably benign Het
Gm5431 G T 11: 48,779,317 (GRCm39) A535D probably damaging Het
Jarid2 C T 13: 45,056,461 (GRCm39) P556S probably damaging Het
Map3k4 C A 17: 12,467,803 (GRCm39) G1077V probably damaging Het
Mast4 C T 13: 102,941,155 (GRCm39) V301I probably damaging Het
Mlxip A G 5: 123,583,735 (GRCm39) T433A possibly damaging Het
Ms4a20 A G 19: 11,089,678 (GRCm39) probably null Het
Mus81 G T 19: 5,535,554 (GRCm39) H199Q probably benign Het
Mylk3 G A 8: 86,085,892 (GRCm39) T54M probably damaging Het
Nalcn A G 14: 123,551,506 (GRCm39) F1034L possibly damaging Het
Nfatc1 A C 18: 80,710,228 (GRCm39) S513A probably benign Het
Ninj2 A G 6: 120,175,092 (GRCm39) I88V possibly damaging Het
Nomo1 C T 7: 45,695,391 (GRCm39) P277L probably damaging Het
Nup214 C T 2: 31,941,810 (GRCm39) S571L probably damaging Het
Or10g9b T A 9: 39,918,009 (GRCm39) M79L probably benign Het
Or5b3 T A 19: 13,388,792 (GRCm39) N286K probably damaging Het
Or9a7 T C 6: 40,521,590 (GRCm39) S108G probably benign Het
Pcdh15 C T 10: 74,338,519 (GRCm39) P1005S probably damaging Het
Pkhd1l1 G A 15: 44,375,070 (GRCm39) A942T possibly damaging Het
Plagl1 T C 10: 13,000,860 (GRCm39) C34R probably damaging Het
Plekha2 T C 8: 25,549,280 (GRCm39) Q168R probably benign Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plekhm3 T G 1: 64,931,912 (GRCm39) K564T possibly damaging Het
Plpp2 A G 10: 79,366,380 (GRCm39) V26A possibly damaging Het
Prdm10 T G 9: 31,241,119 (GRCm39) Y302* probably null Het
Prdm8 A G 5: 98,332,471 (GRCm39) E124G probably damaging Het
Prg4 T G 1: 150,331,657 (GRCm39) probably benign Het
Qser1 A G 2: 104,618,475 (GRCm39) V779A probably benign Het
Rbm39 G A 2: 156,009,504 (GRCm39) R123C probably damaging Het
Ric1 C T 19: 29,565,172 (GRCm39) P640S probably damaging Het
Rpl14 G A 9: 120,403,293 (GRCm39) probably benign Het
Rsl1d1 T A 16: 11,011,558 (GRCm39) D382V probably benign Het
Rubcn G T 16: 32,688,514 (GRCm39) probably benign Het
Sec16a G A 2: 26,320,498 (GRCm39) R1361C probably damaging Het
Slc26a11 T G 11: 119,247,798 (GRCm39) V41G probably damaging Het
Slc41a2 A G 10: 83,151,960 (GRCm39) F172L possibly damaging Het
Slc4a4 A C 5: 89,327,690 (GRCm39) Y674S probably damaging Het
Spata31e3 A T 13: 50,401,007 (GRCm39) Y440N possibly damaging Het
Strc A C 2: 121,208,495 (GRCm39) M292R probably benign Het
Syde2 A G 3: 145,694,381 (GRCm39) T210A probably benign Het
Tcf7l2 C A 19: 55,743,480 (GRCm39) A97E probably benign Het
Tenm3 C T 8: 48,689,474 (GRCm39) D2038N probably damaging Het
Tepsin G A 11: 119,986,190 (GRCm39) T168M probably damaging Het
Tex15 A T 8: 34,047,456 (GRCm39) M178L probably benign Het
Tgfbr2 T C 9: 115,939,119 (GRCm39) N236S probably damaging Het
Tnrc18 A G 5: 142,713,744 (GRCm39) V2531A probably damaging Het
Ttn T G 2: 76,725,767 (GRCm39) probably benign Het
Tubgcp3 G T 8: 12,687,000 (GRCm39) D630E probably damaging Het
Ubr4 G A 4: 139,133,839 (GRCm39) W745* probably null Het
Vmn2r115 G A 17: 23,564,989 (GRCm39) G292D probably benign Het
Vmn2r38 T A 7: 9,078,340 (GRCm39) K681* probably null Het
Xrcc6 A G 15: 81,915,375 (GRCm39) K98E probably benign Het
Zfp423 A G 8: 88,530,407 (GRCm39) V13A probably benign Het
Zfp512b A G 2: 181,228,141 (GRCm39) I5T possibly damaging Het
Zmynd8 C T 2: 165,717,670 (GRCm39) E14K probably damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CATCAAAATTGTGCCTTGCCTG -3'
(R):5'- CCTTCTCAGTGATGGGATTGTC -3'

Sequencing Primer
(F):5'- CAAAATTGTGCCTTGCCTGTAATTTC -3'
(R):5'- CTCAGTGATGGGATTGTCTAAGGAAG -3'
Posted On 2018-11-28