Mutagenetix > Incidental Mutations

Incidental Mutation 'R6970:Sec16a'

542153

Institutional Source

Beutler Lab

Gene Symbol

Sec16a

Ensembl Gene

ENSMUSG00000026924

Gene Name

SEC16 homolog A, endoplasmic reticulum export factor

Synonyms

C230052J16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R6970 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

26409431-26445216 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 26430486 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1361 (R1361C)

Ref Sequence

ENSEMBL: ENSMUSP00000109716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]

AlphaFold

E9QAT4

Predicted Effect

probably damaging
Transcript: ENSMUST00000091252
AA Change: R1361C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: R1361C

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1463	1565	3.1e-24	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1635	1898	2.3e-39	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114082
AA Change: R1361C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: R1361C

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1464	1564	2.6e-10	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1636	1887	6.8e-45	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC
low complexity region	2310	2320	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156442

SMART Domains

Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924

Domain	Start	End	E-Value	Type
Pfam:Sec16	14	114	7.7e-11	PFAM
low complexity region	150	164	N/A	INTRINSIC
Pfam:Sec16_C	186	438	1.6e-45	PFAM
low complexity region	659	674	N/A	INTRINSIC
low complexity region	715	727	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	777	792	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,112,314		probably null	Het
2410089E03Rik	T	C	15: 8,187,548	V750A	probably benign	Het
Acadsb	T	C	7: 131,434,315	Y285H	possibly damaging	Het
Adam17	A	G	12: 21,345,668	S285P	probably benign	Het
Adcy10	A	G	1: 165,556,916	N1082S	probably benign	Het
Ahdc1	T	A	4: 133,062,345	L299Q	possibly damaging	Het
Ambra1	T	A	2: 91,772,600		probably benign	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Atp8a1	A	G	5: 67,738,462	V543A	probably damaging	Het
BC034090	T	A	1: 155,241,439	D311V	probably damaging	Het
Blnk	G	T	19: 40,962,377	P110Q	probably damaging	Het
Cc2d2a	A	G	5: 43,718,585	E968G	probably damaging	Het
Ccdc14	A	T	16: 34,709,533	E394V	probably damaging	Het
Ccdc162	A	T	10: 41,615,958	H1086Q	probably benign	Het
Ccdc85b	T	A	19: 5,457,220	I60F	probably damaging	Het
Ceacam20	T	A	7: 19,989,977	L562Q	probably damaging	Het
Cntrl	T	C	2: 35,118,137	F188L	probably benign	Het
Dclk1	A	T	3: 55,466,601		probably benign	Het
Ddx20	A	T	3: 105,680,358	L434H	probably damaging	Het
Ddx51	G	A	5: 110,656,862	V547M	probably damaging	Het
Dnah11	T	A	12: 118,108,944	Q1472L	probably benign	Het
Dnajb13	T	C	7: 100,507,422	E149G	probably damaging	Het
Fat4	A	G	3: 38,981,775	N3192S	probably damaging	Het
Fat4	A	T	3: 38,995,971	D3994V	probably damaging	Het
Fcgr1	C	A	3: 96,284,620		probably null	Het
Gm11639	A	G	11: 104,776,356	E1422G	probably benign	Het
Gm12185	G	A	11: 48,907,912	R585*	probably null	Het
Gm32687	A	G	10: 81,879,470	H232R	probably benign	Het
Gm5431	G	T	11: 48,888,490	A535D	probably damaging	Het
Gm8300	G	T	12: 87,516,618		probably benign	Het
Gm906	A	T	13: 50,246,971	Y440N	possibly damaging	Het
Jarid2	C	T	13: 44,902,985	P556S	probably damaging	Het
Map3k4	C	A	17: 12,248,916	G1077V	probably damaging	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mlxip	A	G	5: 123,445,672	T433A	possibly damaging	Het
Mus81	G	T	19: 5,485,526	H199Q	probably benign	Het
Mylk3	G	A	8: 85,359,263	T54M	probably damaging	Het
Nalcn	A	G	14: 123,314,094	F1034L	possibly damaging	Het
Nfatc1	A	C	18: 80,667,013	S513A	probably benign	Het
Ninj2	A	G	6: 120,198,131	I88V	possibly damaging	Het
Nomo1	C	T	7: 46,045,967	P277L	probably damaging	Het
Nup214	C	T	2: 32,051,798	S571L	probably damaging	Het
Olfr1469	T	A	19: 13,411,428	N286K	probably damaging	Het
Olfr461	T	C	6: 40,544,656	S108G	probably benign	Het
Olfr980	T	A	9: 40,006,713	M79L	probably benign	Het
Pcdh15	C	T	10: 74,502,687	P1005S	probably damaging	Het
Pkhd1l1	G	A	15: 44,511,674	A942T	possibly damaging	Het
Plagl1	T	C	10: 13,125,116	C34R	probably damaging	Het
Plekha2	T	C	8: 25,059,264	Q168R	probably benign	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plekhm3	T	G	1: 64,892,753	K564T	possibly damaging	Het
Plpp2	A	G	10: 79,530,546	V26A	possibly damaging	Het
Prdm10	T	G	9: 31,329,823	Y302*	probably null	Het
Prdm8	A	G	5: 98,184,612	E124G	probably damaging	Het
Prg4	T	G	1: 150,455,906		probably benign	Het
Qser1	A	G	2: 104,788,130	V779A	probably benign	Het
Rbm39	G	A	2: 156,167,584	R123C	probably damaging	Het
Ric1	C	T	19: 29,587,772	P640S	probably damaging	Het
Rpl14	G	A	9: 120,574,227		probably benign	Het
Rsl1d1	T	A	16: 11,193,694	D382V	probably benign	Het
Rubcn	G	T	16: 32,868,144		probably benign	Het
Slc26a11	T	G	11: 119,356,972	V41G	probably damaging	Het
Slc41a2	A	G	10: 83,316,096	F172L	possibly damaging	Het
Slc4a4	A	C	5: 89,179,831	Y674S	probably damaging	Het
Strc	A	C	2: 121,378,014	M292R	probably benign	Het
Syde2	A	G	3: 145,988,626	T210A	probably benign	Het
Tcf7l2	C	A	19: 55,755,048	A97E	probably benign	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tepsin	G	A	11: 120,095,364	T168M	probably damaging	Het
Tex15	A	T	8: 33,557,428	M178L	probably benign	Het
Tgfbr2	T	C	9: 116,110,051	N236S	probably damaging	Het
Tnrc18	A	G	5: 142,727,989	V2531A	probably damaging	Het
Ttn	T	G	2: 76,895,423		probably benign	Het
Tubgcp3	G	T	8: 12,637,000	D630E	probably damaging	Het
Ubr4	G	A	4: 139,406,528	W745*	probably null	Het
Vmn2r115	G	A	17: 23,346,015	G292D	probably benign	Het
Vmn2r38	T	A	7: 9,075,341	K681*	probably null	Het
Xrcc6	A	G	15: 82,031,174	K98E	probably benign	Het
Zfp423	A	G	8: 87,803,779	V13A	probably benign	Het
Zfp512b	A	G	2: 181,586,348	I5T	possibly damaging	Het
Zmynd8	C	T	2: 165,875,750	E14K	probably damaging	Het

Other mutations in Sec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sec16a	APN	2	26439487	missense	probably benign	0.15
IGL00435:Sec16a	APN	2	26430101	missense	probably benign	0.00
IGL00469:Sec16a	APN	2	26428300	missense	probably damaging	1.00
IGL01622:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL01623:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL02158:Sec16a	APN	2	26416632	critical splice donor site	probably null
IGL02188:Sec16a	APN	2	26436008	missense	probably damaging	1.00
IGL02445:Sec16a	APN	2	26422040	missense	probably benign
IGL02568:Sec16a	APN	2	26436042	missense	probably damaging	1.00
IGL02710:Sec16a	APN	2	26430130	missense	possibly damaging	0.75
IGL02735:Sec16a	APN	2	26428137	splice site	probably benign
IGL02964:Sec16a	APN	2	26419723	missense	probably benign	0.00
IGL03027:Sec16a	APN	2	26423589	missense	probably benign	0.13
IGL03073:Sec16a	APN	2	26439183	missense	probably benign	0.02
IGL03297:Sec16a	APN	2	26439190	missense	probably benign	0.05
IGL03339:Sec16a	APN	2	26435933	missense	probably benign
H8562:Sec16a	UTSW	2	26441505	missense	probably benign
IGL03050:Sec16a	UTSW	2	26415747	missense	probably damaging	1.00
PIT4486001:Sec16a	UTSW	2	26425773	missense
R0039:Sec16a	UTSW	2	26423914	missense	probably benign	0.03
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0189:Sec16a	UTSW	2	26424414	splice site	probably null
R0255:Sec16a	UTSW	2	26431186	missense	probably damaging	0.97
R0278:Sec16a	UTSW	2	26428316	missense	probably damaging	1.00
R0739:Sec16a	UTSW	2	26441051	missense	possibly damaging	0.94
R0743:Sec16a	UTSW	2	26419722	missense	possibly damaging	0.67
R1446:Sec16a	UTSW	2	26423567	missense	probably benign	0.00
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1501:Sec16a	UTSW	2	26440045	missense	probably benign	0.16
R1524:Sec16a	UTSW	2	26428382	missense	probably damaging	1.00
R1584:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1649:Sec16a	UTSW	2	26425524	missense	probably damaging	1.00
R1744:Sec16a	UTSW	2	26439186	missense	probably damaging	1.00
R1959:Sec16a	UTSW	2	26430132	missense	probably benign	0.00
R1973:Sec16a	UTSW	2	26426489	missense	probably damaging	1.00
R2005:Sec16a	UTSW	2	26439080	missense	probably benign	0.27
R2073:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2074:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2075:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2151:Sec16a	UTSW	2	26413745	intron	probably benign
R2472:Sec16a	UTSW	2	26439936	missense	probably damaging	1.00
R2512:Sec16a	UTSW	2	26439025	missense	probably benign	0.00
R2520:Sec16a	UTSW	2	26441356	nonsense	probably null
R2571:Sec16a	UTSW	2	26439331	missense	probably benign	0.08
R3105:Sec16a	UTSW	2	26438421	missense	probably benign	0.14
R3508:Sec16a	UTSW	2	26425850	missense	probably damaging	1.00
R3809:Sec16a	UTSW	2	26441813	missense	possibly damaging	0.71
R3912:Sec16a	UTSW	2	26414387	missense	probably damaging	0.97
R4292:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4293:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4294:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4576:Sec16a	UTSW	2	26431119	nonsense	probably null
R4611:Sec16a	UTSW	2	26441805	missense	probably benign	0.04
R4627:Sec16a	UTSW	2	26429393	missense	probably damaging	1.00
R4627:Sec16a	UTSW	2	26431068	splice site	probably null
R4662:Sec16a	UTSW	2	26430570	missense	probably damaging	1.00
R4665:Sec16a	UTSW	2	26412958	intron	probably benign
R4906:Sec16a	UTSW	2	26441967	unclassified	probably benign
R4967:Sec16a	UTSW	2	26412871	missense	probably benign	0.00
R4983:Sec16a	UTSW	2	26439519	missense	probably benign
R5033:Sec16a	UTSW	2	26419649	missense	probably benign	0.00
R5251:Sec16a	UTSW	2	26439345	missense	probably benign	0.00
R5391:Sec16a	UTSW	2	26440032	missense	possibly damaging	0.82
R5457:Sec16a	UTSW	2	26440268	missense	probably benign	0.01
R5530:Sec16a	UTSW	2	26439252	missense	probably benign	0.00
R5645:Sec16a	UTSW	2	26439895	missense	probably benign	0.01
R5661:Sec16a	UTSW	2	26439637	missense	probably benign	0.01
R5770:Sec16a	UTSW	2	26414390	missense	probably damaging	0.99
R5830:Sec16a	UTSW	2	26440841	missense	probably benign	0.15
R5866:Sec16a	UTSW	2	26419638	missense	probably benign	0.00
R5875:Sec16a	UTSW	2	26433367	missense	probably damaging	1.00
R5906:Sec16a	UTSW	2	26438831	missense	possibly damaging	0.63
R5922:Sec16a	UTSW	2	26415639	missense	probably benign	0.05
R6076:Sec16a	UTSW	2	26423942	missense	probably damaging	1.00
R6091:Sec16a	UTSW	2	26426470	missense	probably damaging	1.00
R6295:Sec16a	UTSW	2	26428241	missense	probably damaging	1.00
R6302:Sec16a	UTSW	2	26425805	missense	probably damaging	1.00
R6309:Sec16a	UTSW	2	26438571	missense	probably benign	0.00
R6459:Sec16a	UTSW	2	26423500	missense	probably benign	0.04
R6520:Sec16a	UTSW	2	26426106	missense	probably damaging	1.00
R6631:Sec16a	UTSW	2	26439957	missense	probably damaging	1.00
R6657:Sec16a	UTSW	2	26425864	nonsense	probably null
R6750:Sec16a	UTSW	2	26440018	missense	probably benign	0.00
R6852:Sec16a	UTSW	2	26441419	missense	probably damaging	0.99
R6860:Sec16a	UTSW	2	26430112	missense	probably damaging	1.00
R6967:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6968:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6991:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6993:Sec16a	UTSW	2	26423574	missense	probably damaging	0.99
R7009:Sec16a	UTSW	2	26436002	nonsense	probably null
R7057:Sec16a	UTSW	2	26425265	missense	probably damaging	1.00
R7186:Sec16a	UTSW	2	26440703	nonsense	probably null
R7227:Sec16a	UTSW	2	26438923	missense	probably benign	0.01
R7234:Sec16a	UTSW	2	26439768	missense	probably damaging	1.00
R7259:Sec16a	UTSW	2	26441592	missense	probably benign	0.00
R7326:Sec16a	UTSW	2	26439717	missense	unknown
R7371:Sec16a	UTSW	2	26441722	missense	probably benign
R7388:Sec16a	UTSW	2	26428364	missense
R7414:Sec16a	UTSW	2	26423631	missense
R7417:Sec16a	UTSW	2	26421397	missense
R7501:Sec16a	UTSW	2	26441851	missense	probably damaging	1.00
R7558:Sec16a	UTSW	2	26439734	missense
R7696:Sec16a	UTSW	2	26415633	critical splice donor site	probably null
R7981:Sec16a	UTSW	2	26421372	critical splice donor site	probably null
R8117:Sec16a	UTSW	2	26441429	missense	probably benign	0.00
R8131:Sec16a	UTSW	2	26410946	missense
R8163:Sec16a	UTSW	2	26416421	missense
R8825:Sec16a	UTSW	2	26423574	missense
R8855:Sec16a	UTSW	2	26439840	missense	probably benign	0.16
R9165:Sec16a	UTSW	2	26423633	missense
R9216:Sec16a	UTSW	2	26414389	missense
R9283:Sec16a	UTSW	2	26423892	missense
X0011:Sec16a	UTSW	2	26415643	missense	probably damaging	1.00
X0034:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
X0062:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
Z1088:Sec16a	UTSW	2	26439093	missense	probably damaging	0.99
Z1176:Sec16a	UTSW	2	26438748	missense
Z1177:Sec16a	UTSW	2	26439321	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAGTCCCCATGAACACCAG -3'
(R):5'- TGCAGCCTCAGAAAGTTCTTGG -3'

Sequencing Primer
(F):5'- CACCAGAAAGACTGTGGGTAC -3'
(R):5'- CAGCCTCAGAAAGTTCTTGGTAGTTG -3'

Posted On

2018-11-28