Mutagenetix > Incidental Mutations

Incidental Mutation 'R6970:Nup214'

542154

Institutional Source

Beutler Lab

Gene Symbol

Nup214

Ensembl Gene

ENSMUSG00000001855

Gene Name

nucleoporin 214

Synonyms

CAN, D2H9S46E

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6970 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31974436-32053975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 32051798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 571 (S571L)

Ref Sequence

ENSEMBL: ENSMUSP00000115665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012] [ENSMUST00000139629] [ENSMUST00000152791]

AlphaFold

Q80U93

Predicted Effect

probably damaging
Transcript: ENSMUST00000065398
AA Change: S2075L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S2075L

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000138012
AA Change: S571L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855
AA Change: S571L

Domain	Start	End	E-Value	Type
low complexity region	54	68	N/A	INTRINSIC
low complexity region	106	137	N/A	INTRINSIC
low complexity region	153	165	N/A	INTRINSIC
low complexity region	181	210	N/A	INTRINSIC
low complexity region	228	243	N/A	INTRINSIC
low complexity region	266	278	N/A	INTRINSIC
low complexity region	294	327	N/A	INTRINSIC
low complexity region	348	368	N/A	INTRINSIC
low complexity region	373	382	N/A	INTRINSIC
low complexity region	394	406	N/A	INTRINSIC
low complexity region	421	430	N/A	INTRINSIC
low complexity region	465	491	N/A	INTRINSIC
low complexity region	503	528	N/A	INTRINSIC
low complexity region	544	572	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139629

Predicted Effect

possibly damaging
Transcript: ENSMUST00000152791
AA Change: R73C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,112,314		probably null	Het
2410089E03Rik	T	C	15: 8,187,548	V750A	probably benign	Het
Acadsb	T	C	7: 131,434,315	Y285H	possibly damaging	Het
Adam17	A	G	12: 21,345,668	S285P	probably benign	Het
Adcy10	A	G	1: 165,556,916	N1082S	probably benign	Het
Ahdc1	T	A	4: 133,062,345	L299Q	possibly damaging	Het
Ambra1	T	A	2: 91,772,600		probably benign	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Atp8a1	A	G	5: 67,738,462	V543A	probably damaging	Het
BC034090	T	A	1: 155,241,439	D311V	probably damaging	Het
Blnk	G	T	19: 40,962,377	P110Q	probably damaging	Het
Cc2d2a	A	G	5: 43,718,585	E968G	probably damaging	Het
Ccdc14	A	T	16: 34,709,533	E394V	probably damaging	Het
Ccdc162	A	T	10: 41,615,958	H1086Q	probably benign	Het
Ccdc85b	T	A	19: 5,457,220	I60F	probably damaging	Het
Ceacam20	T	A	7: 19,989,977	L562Q	probably damaging	Het
Cntrl	T	C	2: 35,118,137	F188L	probably benign	Het
Dclk1	A	T	3: 55,466,601		probably benign	Het
Ddx20	A	T	3: 105,680,358	L434H	probably damaging	Het
Ddx51	G	A	5: 110,656,862	V547M	probably damaging	Het
Dnah11	T	A	12: 118,108,944	Q1472L	probably benign	Het
Dnajb13	T	C	7: 100,507,422	E149G	probably damaging	Het
Fat4	A	G	3: 38,981,775	N3192S	probably damaging	Het
Fat4	A	T	3: 38,995,971	D3994V	probably damaging	Het
Fcgr1	C	A	3: 96,284,620		probably null	Het
Gm11639	A	G	11: 104,776,356	E1422G	probably benign	Het
Gm12185	G	A	11: 48,907,912	R585*	probably null	Het
Gm32687	A	G	10: 81,879,470	H232R	probably benign	Het
Gm5431	G	T	11: 48,888,490	A535D	probably damaging	Het
Gm8300	G	T	12: 87,516,618		probably benign	Het
Gm906	A	T	13: 50,246,971	Y440N	possibly damaging	Het
Jarid2	C	T	13: 44,902,985	P556S	probably damaging	Het
Map3k4	C	A	17: 12,248,916	G1077V	probably damaging	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mlxip	A	G	5: 123,445,672	T433A	possibly damaging	Het
Mus81	G	T	19: 5,485,526	H199Q	probably benign	Het
Mylk3	G	A	8: 85,359,263	T54M	probably damaging	Het
Nalcn	A	G	14: 123,314,094	F1034L	possibly damaging	Het
Nfatc1	A	C	18: 80,667,013	S513A	probably benign	Het
Ninj2	A	G	6: 120,198,131	I88V	possibly damaging	Het
Nomo1	C	T	7: 46,045,967	P277L	probably damaging	Het
Olfr1469	T	A	19: 13,411,428	N286K	probably damaging	Het
Olfr461	T	C	6: 40,544,656	S108G	probably benign	Het
Olfr980	T	A	9: 40,006,713	M79L	probably benign	Het
Pcdh15	C	T	10: 74,502,687	P1005S	probably damaging	Het
Pkhd1l1	G	A	15: 44,511,674	A942T	possibly damaging	Het
Plagl1	T	C	10: 13,125,116	C34R	probably damaging	Het
Plekha2	T	C	8: 25,059,264	Q168R	probably benign	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plekhm3	T	G	1: 64,892,753	K564T	possibly damaging	Het
Plpp2	A	G	10: 79,530,546	V26A	possibly damaging	Het
Prdm10	T	G	9: 31,329,823	Y302*	probably null	Het
Prdm8	A	G	5: 98,184,612	E124G	probably damaging	Het
Prg4	T	G	1: 150,455,906		probably benign	Het
Qser1	A	G	2: 104,788,130	V779A	probably benign	Het
Rbm39	G	A	2: 156,167,584	R123C	probably damaging	Het
Ric1	C	T	19: 29,587,772	P640S	probably damaging	Het
Rpl14	G	A	9: 120,574,227		probably benign	Het
Rsl1d1	T	A	16: 11,193,694	D382V	probably benign	Het
Rubcn	G	T	16: 32,868,144		probably benign	Het
Sec16a	G	A	2: 26,430,486	R1361C	probably damaging	Het
Slc26a11	T	G	11: 119,356,972	V41G	probably damaging	Het
Slc41a2	A	G	10: 83,316,096	F172L	possibly damaging	Het
Slc4a4	A	C	5: 89,179,831	Y674S	probably damaging	Het
Strc	A	C	2: 121,378,014	M292R	probably benign	Het
Syde2	A	G	3: 145,988,626	T210A	probably benign	Het
Tcf7l2	C	A	19: 55,755,048	A97E	probably benign	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tepsin	G	A	11: 120,095,364	T168M	probably damaging	Het
Tex15	A	T	8: 33,557,428	M178L	probably benign	Het
Tgfbr2	T	C	9: 116,110,051	N236S	probably damaging	Het
Tnrc18	A	G	5: 142,727,989	V2531A	probably damaging	Het
Ttn	T	G	2: 76,895,423		probably benign	Het
Tubgcp3	G	T	8: 12,637,000	D630E	probably damaging	Het
Ubr4	G	A	4: 139,406,528	W745*	probably null	Het
Vmn2r115	G	A	17: 23,346,015	G292D	probably benign	Het
Vmn2r38	T	A	7: 9,075,341	K681*	probably null	Het
Xrcc6	A	G	15: 82,031,174	K98E	probably benign	Het
Zfp423	A	G	8: 87,803,779	V13A	probably benign	Het
Zfp512b	A	G	2: 181,586,348	I5T	possibly damaging	Het
Zmynd8	C	T	2: 165,875,750	E14K	probably damaging	Het

Other mutations in Nup214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nup214	APN	2	32033979	missense	probably damaging	1.00
IGL00649:Nup214	APN	2	32006721	missense	probably benign	0.27
IGL01149:Nup214	APN	2	32034700	missense	probably damaging	1.00
IGL01360:Nup214	APN	2	32038178	unclassified	probably benign
IGL01409:Nup214	APN	2	32026931	splice site	probably null
IGL01530:Nup214	APN	2	32033721	missense	probably benign
IGL01554:Nup214	APN	2	32051072	nonsense	probably null
IGL01944:Nup214	APN	2	32034959	nonsense	probably null
IGL02296:Nup214	APN	2	31988188	missense	possibly damaging	0.65
IGL02563:Nup214	APN	2	31977860	missense	probably damaging	1.00
IGL02688:Nup214	APN	2	32031275	missense	probably benign
IGL02858:Nup214	APN	2	32010372	splice site	probably benign
IGL02953:Nup214	APN	2	31988229	missense	possibly damaging	0.87
IGL03090:Nup214	APN	2	32018242	missense	probably benign	0.01
IGL03124:Nup214	APN	2	31996440	missense	probably benign	0.27
IGL03225:Nup214	APN	2	32034411	missense	probably damaging	1.00
IGL03375:Nup214	APN	2	32010221	missense	probably damaging	0.97
Des_moines	UTSW	2	31980584	splice site	probably null
ANU74:Nup214	UTSW	2	32034966	missense	probably damaging	0.99
R0035:Nup214	UTSW	2	31990367	splice site	probably null
R0243:Nup214	UTSW	2	31998057	splice site	probably benign
R0270:Nup214	UTSW	2	32034814	missense	probably damaging	0.96
R0358:Nup214	UTSW	2	32004300	splice site	probably null
R1168:Nup214	UTSW	2	32025301	missense	probably benign
R1242:Nup214	UTSW	2	31977770	missense	probably benign	0.00
R1481:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1482:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1579:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1580:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1581:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1610:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1894:Nup214	UTSW	2	31996380	missense	possibly damaging	0.66
R2146:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R2149:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R2293:Nup214	UTSW	2	32026875	missense	probably benign
R2924:Nup214	UTSW	2	31998003	missense	probably damaging	1.00
R2925:Nup214	UTSW	2	31998003	missense	probably damaging	1.00
R3037:Nup214	UTSW	2	31976620	missense	probably benign	0.00
R3426:Nup214	UTSW	2	32033403	missense	probably damaging	0.97
R3799:Nup214	UTSW	2	32034682	missense	probably damaging	1.00
R3843:Nup214	UTSW	2	32051100	missense	probably damaging	1.00
R4323:Nup214	UTSW	2	31994684	missense	probably benign
R4353:Nup214	UTSW	2	31977917	critical splice donor site	probably null
R4601:Nup214	UTSW	2	31997965	missense	probably benign	0.36
R4626:Nup214	UTSW	2	32033404	missense	possibly damaging	0.92
R4874:Nup214	UTSW	2	31980584	splice site	probably null
R4938:Nup214	UTSW	2	31983159	missense	probably benign	0.00
R4939:Nup214	UTSW	2	31983159	missense	probably benign	0.00
R5027:Nup214	UTSW	2	31991317	missense	probably damaging	1.00
R5358:Nup214	UTSW	2	32017146	missense	unknown
R5406:Nup214	UTSW	2	32002607	missense	probably damaging	0.96
R5507:Nup214	UTSW	2	31988176	missense	possibly damaging	0.87
R5695:Nup214	UTSW	2	32034373	missense	probably damaging	1.00
R5744:Nup214	UTSW	2	32010296	missense	probably damaging	0.97
R5908:Nup214	UTSW	2	31991341	missense	probably benign	0.03
R5967:Nup214	UTSW	2	31979778	missense	possibly damaging	0.52
R6140:Nup214	UTSW	2	32051796	missense	possibly damaging	0.92
R6243:Nup214	UTSW	2	32002932	missense	possibly damaging	0.81
R6488:Nup214	UTSW	2	31991372	missense	possibly damaging	0.93
R6934:Nup214	UTSW	2	31982671	nonsense	probably null
R7028:Nup214	UTSW	2	32034156	missense	probably benign	0.22
R7114:Nup214	UTSW	2	32025244	missense	possibly damaging	0.83
R7120:Nup214	UTSW	2	32051042	missense	probably benign	0.07
R7249:Nup214	UTSW	2	31988233	missense	possibly damaging	0.92
R7821:Nup214	UTSW	2	32026905	missense	possibly damaging	0.83
R8026:Nup214	UTSW	2	32033350	missense	possibly damaging	0.55
R8264:Nup214	UTSW	2	31994726	missense	possibly damaging	0.79
R8284:Nup214	UTSW	2	31996446	missense	possibly damaging	0.83
R8356:Nup214	UTSW	2	32039360	missense	probably benign	0.05
R8397:Nup214	UTSW	2	31990254	missense	probably damaging	0.96
R8456:Nup214	UTSW	2	32039360	missense	probably benign	0.05
R8785:Nup214	UTSW	2	32034453	missense	probably damaging	0.97
R9257:Nup214	UTSW	2	32033335	missense	possibly damaging	0.92
R9291:Nup214	UTSW	2	31977794	missense	probably benign	0.00
R9376:Nup214	UTSW	2	32034232	missense	probably benign	0.00
R9408:Nup214	UTSW	2	32047511	missense	probably damaging	1.00
RF015:Nup214	UTSW	2	32034706	missense	probably benign	0.00
X0026:Nup214	UTSW	2	32020306	missense	possibly damaging	0.46
X0065:Nup214	UTSW	2	32042476	missense	probably damaging	1.00
Z1088:Nup214	UTSW	2	32011223	missense	probably benign	0.27
Z1176:Nup214	UTSW	2	32010258	missense	possibly damaging	0.66
Z1176:Nup214	UTSW	2	32034225	nonsense	probably null
Z1177:Nup214	UTSW	2	31997959	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AGTGCACAGACCGTTACCTG -3'
(R):5'- AGGCCAATCATCTCTTACTCAG -3'

Sequencing Primer
(F):5'- ACCGTTACCTGCAGCCAGAG -3'
(R):5'- TACTCAGCCTCCCGCAG -3'

Posted On

2018-11-28