Incidental Mutation 'R6970:Nup214'
ID 542154
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Name nucleoporin 214
Synonyms CAN, D2H9S46E
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6970 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 31974436-32053975 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32051798 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 571 (S571L)
Ref Sequence ENSEMBL: ENSMUSP00000115665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012] [ENSMUST00000139629] [ENSMUST00000152791]
AlphaFold Q80U93
Predicted Effect probably damaging
Transcript: ENSMUST00000065398
AA Change: S2075L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S2075L

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138012
AA Change: S571L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855
AA Change: S571L

DomainStartEndE-ValueType
low complexity region 54 68 N/A INTRINSIC
low complexity region 106 137 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 181 210 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
low complexity region 266 278 N/A INTRINSIC
low complexity region 294 327 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 373 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
low complexity region 503 528 N/A INTRINSIC
low complexity region 544 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139629
Predicted Effect possibly damaging
Transcript: ENSMUST00000152791
AA Change: R73C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 32033979 missense probably damaging 1.00
IGL00649:Nup214 APN 2 32006721 missense probably benign 0.27
IGL01149:Nup214 APN 2 32034700 missense probably damaging 1.00
IGL01360:Nup214 APN 2 32038178 unclassified probably benign
IGL01409:Nup214 APN 2 32026931 splice site probably null
IGL01530:Nup214 APN 2 32033721 missense probably benign
IGL01554:Nup214 APN 2 32051072 nonsense probably null
IGL01944:Nup214 APN 2 32034959 nonsense probably null
IGL02296:Nup214 APN 2 31988188 missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31977860 missense probably damaging 1.00
IGL02688:Nup214 APN 2 32031275 missense probably benign
IGL02858:Nup214 APN 2 32010372 splice site probably benign
IGL02953:Nup214 APN 2 31988229 missense possibly damaging 0.87
IGL03090:Nup214 APN 2 32018242 missense probably benign 0.01
IGL03124:Nup214 APN 2 31996440 missense probably benign 0.27
IGL03225:Nup214 APN 2 32034411 missense probably damaging 1.00
IGL03375:Nup214 APN 2 32010221 missense probably damaging 0.97
Des_moines UTSW 2 31980584 splice site probably null
ANU74:Nup214 UTSW 2 32034966 missense probably damaging 0.99
R0035:Nup214 UTSW 2 31990367 splice site probably null
R0243:Nup214 UTSW 2 31998057 splice site probably benign
R0270:Nup214 UTSW 2 32034814 missense probably damaging 0.96
R0358:Nup214 UTSW 2 32004300 splice site probably null
R1168:Nup214 UTSW 2 32025301 missense probably benign
R1242:Nup214 UTSW 2 31977770 missense probably benign 0.00
R1481:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1482:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1579:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1580:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1581:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1610:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1894:Nup214 UTSW 2 31996380 missense possibly damaging 0.66
R2146:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2149:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2293:Nup214 UTSW 2 32026875 missense probably benign
R2924:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R2925:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R3037:Nup214 UTSW 2 31976620 missense probably benign 0.00
R3426:Nup214 UTSW 2 32033403 missense probably damaging 0.97
R3799:Nup214 UTSW 2 32034682 missense probably damaging 1.00
R3843:Nup214 UTSW 2 32051100 missense probably damaging 1.00
R4323:Nup214 UTSW 2 31994684 missense probably benign
R4353:Nup214 UTSW 2 31977917 critical splice donor site probably null
R4601:Nup214 UTSW 2 31997965 missense probably benign 0.36
R4626:Nup214 UTSW 2 32033404 missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31980584 splice site probably null
R4938:Nup214 UTSW 2 31983159 missense probably benign 0.00
R4939:Nup214 UTSW 2 31983159 missense probably benign 0.00
R5027:Nup214 UTSW 2 31991317 missense probably damaging 1.00
R5358:Nup214 UTSW 2 32017146 missense unknown
R5406:Nup214 UTSW 2 32002607 missense probably damaging 0.96
R5507:Nup214 UTSW 2 31988176 missense possibly damaging 0.87
R5695:Nup214 UTSW 2 32034373 missense probably damaging 1.00
R5744:Nup214 UTSW 2 32010296 missense probably damaging 0.97
R5908:Nup214 UTSW 2 31991341 missense probably benign 0.03
R5967:Nup214 UTSW 2 31979778 missense possibly damaging 0.52
R6140:Nup214 UTSW 2 32051796 missense possibly damaging 0.92
R6243:Nup214 UTSW 2 32002932 missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31991372 missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31982671 nonsense probably null
R7028:Nup214 UTSW 2 32034156 missense probably benign 0.22
R7114:Nup214 UTSW 2 32025244 missense possibly damaging 0.83
R7120:Nup214 UTSW 2 32051042 missense probably benign 0.07
R7249:Nup214 UTSW 2 31988233 missense possibly damaging 0.92
R7821:Nup214 UTSW 2 32026905 missense possibly damaging 0.83
R8026:Nup214 UTSW 2 32033350 missense possibly damaging 0.55
R8264:Nup214 UTSW 2 31994726 missense possibly damaging 0.79
R8284:Nup214 UTSW 2 31996446 missense possibly damaging 0.83
R8356:Nup214 UTSW 2 32039360 missense probably benign 0.05
R8397:Nup214 UTSW 2 31990254 missense probably damaging 0.96
R8456:Nup214 UTSW 2 32039360 missense probably benign 0.05
R8785:Nup214 UTSW 2 32034453 missense probably damaging 0.97
R9257:Nup214 UTSW 2 32033335 missense possibly damaging 0.92
R9291:Nup214 UTSW 2 31977794 missense probably benign 0.00
R9376:Nup214 UTSW 2 32034232 missense probably benign 0.00
R9408:Nup214 UTSW 2 32047511 missense probably damaging 1.00
RF015:Nup214 UTSW 2 32034706 missense probably benign 0.00
X0026:Nup214 UTSW 2 32020306 missense possibly damaging 0.46
X0065:Nup214 UTSW 2 32042476 missense probably damaging 1.00
Z1088:Nup214 UTSW 2 32011223 missense probably benign 0.27
Z1176:Nup214 UTSW 2 32010258 missense possibly damaging 0.66
Z1176:Nup214 UTSW 2 32034225 nonsense probably null
Z1177:Nup214 UTSW 2 31997959 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGTGCACAGACCGTTACCTG -3'
(R):5'- AGGCCAATCATCTCTTACTCAG -3'

Sequencing Primer
(F):5'- ACCGTTACCTGCAGCCAGAG -3'
(R):5'- TACTCAGCCTCCCGCAG -3'
Posted On 2018-11-28