Incidental Mutation 'R6970:Dclk1'
ID 542165
Institutional Source Beutler Lab
Gene Symbol Dclk1
Ensembl Gene ENSMUSG00000027797
Gene Name doublecortin-like kinase 1
Synonyms 2810480F11Rik, Dcamkl1, CPG16, Click-I, Dcl, DCLK, 1700113D08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_019978; MGI: 1330861

Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock # R6970 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 55242364-55539068 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 55466601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054237] [ENSMUST00000070418] [ENSMUST00000167204] [ENSMUST00000179544] [ENSMUST00000196745] [ENSMUST00000198412] [ENSMUST00000198437] [ENSMUST00000199169] [ENSMUST00000199585] [ENSMUST00000199702] [ENSMUST00000200352]
AlphaFold Q9JLM8
Predicted Effect probably benign
Transcript: ENSMUST00000054237
SMART Domains Protein: ENSMUSP00000050034
Gene: ENSMUSG00000027797

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
S_TKc 406 663 1.71e-104 SMART
low complexity region 736 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070418
SMART Domains Protein: ENSMUSP00000070292
Gene: ENSMUSG00000027797

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 1.71e-104 SMART
Predicted Effect unknown
Transcript: ENSMUST00000167204
AA Change: D355V
SMART Domains Protein: ENSMUSP00000129334
Gene: ENSMUSG00000027797
AA Change: D355V

DomainStartEndE-ValueType
DCX 52 143 1.53e-43 SMART
DCX 181 269 2.53e-35 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179544
Predicted Effect probably benign
Transcript: ENSMUST00000196745
SMART Domains Protein: ENSMUSP00000143659
Gene: ENSMUSG00000027797

DomainStartEndE-ValueType
DCX 52 143 7.3e-46 SMART
DCX 181 269 1.2e-37 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 323 340 N/A INTRINSIC
low complexity region 347 364 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
S_TKc 390 646 8.3e-107 SMART
low complexity region 719 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198412
SMART Domains Protein: ENSMUSP00000142637
Gene: ENSMUSG00000027797

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 339 8.1e-107 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198437
SMART Domains Protein: ENSMUSP00000143016
Gene: ENSMUSG00000027797

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
S_TKc 99 356 1.71e-104 SMART
low complexity region 429 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199169
SMART Domains Protein: ENSMUSP00000143563
Gene: ENSMUSG00000027797

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 8.5e-107 SMART
Predicted Effect unknown
Transcript: ENSMUST00000199585
AA Change: D48V
SMART Domains Protein: ENSMUSP00000142698
Gene: ENSMUSG00000027797
AA Change: D48V

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 44 56 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199702
SMART Domains Protein: ENSMUSP00000143507
Gene: ENSMUSG00000027797

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
S_TKc 82 339 8.5e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200352
SMART Domains Protein: ENSMUSP00000142840
Gene: ENSMUSG00000027797

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
S_TKc 83 340 8.3e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmodulin-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. The encoded protein is involved in several different cellular processes, including neuronal migration, retrograde transport, neuronal apoptosis and neurogenesis. This gene is up-regulated by brain-derived neurotrophic factor and associated with memory and general cognitive abilities. Multiple transcript variants generated by two alternative promoter usage and alternative splicing have been found, but the biological validity of some variants has not been determined. These variants encode different isoforms, which are differentially expressed and have different kinase activities. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a null allele lack the corpus callosum and hippocampal commissure and show aberrant interhemispheric axonal projections. Mice homozygous for a different null allele have normal gross brain architecture but show axonal and dendritic defects following knockdown of Dcx expression. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Dclk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dclk1 APN 3 55247286 missense probably damaging 1.00
IGL02148:Dclk1 APN 3 55500099 missense probably damaging 1.00
IGL02901:Dclk1 APN 3 55487787 splice site probably benign
IGL03086:Dclk1 APN 3 55247367 missense probably damaging 0.96
IGL03213:Dclk1 APN 3 55480384 nonsense probably null
R0037:Dclk1 UTSW 3 55256059 missense probably benign 0.02
R0316:Dclk1 UTSW 3 55502892 missense probably damaging 1.00
R0885:Dclk1 UTSW 3 55487307 missense probably damaging 1.00
R1211:Dclk1 UTSW 3 55380823 missense probably benign 0.05
R1234:Dclk1 UTSW 3 55489877 missense probably damaging 1.00
R1540:Dclk1 UTSW 3 55477823 missense probably damaging 1.00
R1928:Dclk1 UTSW 3 55247521 missense possibly damaging 0.48
R2081:Dclk1 UTSW 3 55521925 critical splice donor site probably null
R2152:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2153:Dclk1 UTSW 3 55247212 missense probably damaging 0.97
R2213:Dclk1 UTSW 3 55480433 missense probably damaging 1.00
R3745:Dclk1 UTSW 3 55247442 missense possibly damaging 0.87
R3899:Dclk1 UTSW 3 55247329 missense probably damaging 0.99
R4569:Dclk1 UTSW 3 55247410 missense probably damaging 1.00
R4851:Dclk1 UTSW 3 55480390 missense probably damaging 1.00
R4890:Dclk1 UTSW 3 55521932 missense probably benign
R5105:Dclk1 UTSW 3 55255939 missense probably benign 0.00
R5175:Dclk1 UTSW 3 55247227 missense possibly damaging 0.80
R5364:Dclk1 UTSW 3 55255945 missense possibly damaging 0.95
R5613:Dclk1 UTSW 3 55516939 missense probably benign 0.15
R5819:Dclk1 UTSW 3 55489864 missense probably damaging 0.98
R6113:Dclk1 UTSW 3 55489819 missense probably benign 0.00
R6162:Dclk1 UTSW 3 55256154 missense probably benign 0.02
R6190:Dclk1 UTSW 3 55487811 missense probably damaging 1.00
R6193:Dclk1 UTSW 3 55516871 critical splice acceptor site probably null
R6380:Dclk1 UTSW 3 55247194 missense probably damaging 1.00
R6406:Dclk1 UTSW 3 55480406 missense probably damaging 1.00
R6543:Dclk1 UTSW 3 55500131 missense probably damaging 1.00
R6745:Dclk1 UTSW 3 55477808 missense probably damaging 1.00
R7037:Dclk1 UTSW 3 55463048 missense probably damaging 1.00
R7086:Dclk1 UTSW 3 55487912 critical splice donor site probably null
R7163:Dclk1 UTSW 3 55256128 nonsense probably null
R7198:Dclk1 UTSW 3 55477875 missense possibly damaging 0.70
R7843:Dclk1 UTSW 3 55255877 missense probably damaging 1.00
R8476:Dclk1 UTSW 3 55533679 missense probably damaging 1.00
R8677:Dclk1 UTSW 3 55502419 missense probably damaging 0.96
R9060:Dclk1 UTSW 3 55256154 missense probably benign 0.02
R9332:Dclk1 UTSW 3 55463079 missense probably damaging 0.98
R9377:Dclk1 UTSW 3 55521953 missense possibly damaging 0.72
R9384:Dclk1 UTSW 3 55247515 missense possibly damaging 0.81
Z1088:Dclk1 UTSW 3 55500105 missense probably damaging 1.00
Z1177:Dclk1 UTSW 3 55256013 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGCGTTTTCTTGCCGATG -3'
(R):5'- GAGTAGAAAATGTCGGCACCCTTG -3'

Sequencing Primer
(F):5'- AAGCGTTTTCTTGCCGATGAAATG -3'
(R):5'- GGGAAACCTTGATCCCAT -3'
Posted On 2018-11-28