Incidental Mutation 'R6970:Prdm8'
ID 542174
Institutional Source Beutler Lab
Gene Symbol Prdm8
Ensembl Gene ENSMUSG00000035456
Gene Name PR domain containing 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock # R6970 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 98167198-98188991 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98184612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 124 (E124G)
Ref Sequence ENSEMBL: ENSMUSP00000147333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112959] [ENSMUST00000210477]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000112959
AA Change: E124G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108583
Gene: ENSMUSG00000035456
AA Change: E124G

DomainStartEndE-ValueType
SET 20 137 1.55e0 SMART
ZnF_C2H2 154 182 2.37e2 SMART
low complexity region 192 219 N/A INTRINSIC
low complexity region 275 291 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 397 427 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 599 621 N/A INTRINSIC
ZnF_C2H2 624 646 9.22e0 SMART
ZnF_C2H2 665 687 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210477
AA Change: E124G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of histone methyltransferases that predominantly act as negative regulators of transcription. The encoded protein contains an N-terminal Su(var)3-9, Enhancer-of-zeste, and Trithorax (SET) domain and a double zinc-finger domain. Knockout of this gene in mouse results in mistargeting by neurons of the dorsal telencephalon, abnormal itch-like behavior, and impaired differentiation of rod bipolar cells. In humans, the protein has been shown to interact with the phosphatase laforin and the ubiquitin ligase malin, which regulate glycogen construction in the cytoplasm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature termination of corticopsinal motor neuron axons, absent corpus callosum and hippocampal commissure, excessive scratching, skin lesions, and contraction of hindpaws resulting a handstand phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Prdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Prdm8 APN 5 98183343 missense probably damaging 1.00
IGL02208:Prdm8 APN 5 98183465 missense possibly damaging 0.93
IGL02676:Prdm8 APN 5 98186559 missense probably damaging 1.00
R0060:Prdm8 UTSW 5 98185260 missense probably benign 0.19
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0630:Prdm8 UTSW 5 98184521 missense probably damaging 1.00
R1099:Prdm8 UTSW 5 98183502 missense probably damaging 0.99
R4373:Prdm8 UTSW 5 98186508 missense probably damaging 1.00
R4643:Prdm8 UTSW 5 98184587 missense possibly damaging 0.61
R4936:Prdm8 UTSW 5 98185022 critical splice acceptor site probably null
R4936:Prdm8 UTSW 5 98185023 critical splice acceptor site probably null
R5033:Prdm8 UTSW 5 98185212 nonsense probably null
R5495:Prdm8 UTSW 5 98185306 missense possibly damaging 0.62
R6307:Prdm8 UTSW 5 98185303 missense possibly damaging 0.84
R6562:Prdm8 UTSW 5 98183343 missense possibly damaging 0.82
R7343:Prdm8 UTSW 5 98184516 missense probably damaging 1.00
R8417:Prdm8 UTSW 5 98184531 missense probably damaging 0.98
R8421:Prdm8 UTSW 5 98185963 missense probably damaging 1.00
R9159:Prdm8 UTSW 5 98186316 missense probably damaging 0.97
Z1177:Prdm8 UTSW 5 98184632 missense probably damaging 1.00
Z1177:Prdm8 UTSW 5 98186551 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTTTCACGTGGATCCCTC -3'
(R):5'- TTACTAAGTCAAACGCTCCCCA -3'

Sequencing Primer
(F):5'- ACGTGGATCCCTCTCTTCTTG -3'
(R):5'- TAAGTCAAACGCTCCCCAACTTTTC -3'
Posted On 2018-11-28