Incidental Mutation 'R6970:Plekha2'
ID 542186
Institutional Source Beutler Lab
Gene Symbol Plekha2
Ensembl Gene ENSMUSG00000031557
Gene Name pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2
Synonyms 6430512N22Rik, TAPP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6970 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 25039144-25102376 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25059264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 168 (Q168R)
Ref Sequence ENSEMBL: ENSMUSP00000122564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064883] [ENSMUST00000098866] [ENSMUST00000125466] [ENSMUST00000128715]
AlphaFold Q9ERS5
Predicted Effect probably benign
Transcript: ENSMUST00000064883
AA Change: Q168R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066546
Gene: ENSMUSG00000031557
AA Change: Q168R

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098866
AA Change: Q168R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096464
Gene: ENSMUSG00000031557
AA Change: Q168R

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125466
SMART Domains Protein: ENSMUSP00000116764
Gene: ENSMUSG00000031557

DomainStartEndE-ValueType
PDB:1V5P|A 1 95 4e-68 PDB
Blast:PH 8 95 9e-61 BLAST
SCOP:d1eaza_ 11 95 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128715
AA Change: Q168R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122564
Gene: ENSMUSG00000031557
AA Change: Q168R

DomainStartEndE-ValueType
PH 8 115 3.11e-10 SMART
PH 199 300 1.91e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Plekha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Plekha2 APN 8 25057327 missense probably damaging 0.98
IGL02123:Plekha2 APN 8 25042729 missense probably damaging 1.00
abstruse UTSW 8 25088391 missense probably damaging 1.00
Byzantine UTSW 8 25088395 missense probably damaging 1.00
Complexity UTSW 8 25057298 missense probably damaging 1.00
Elaborate UTSW 8 25043047 splice site probably null
R1178:Plekha2 UTSW 8 25059202 missense probably benign 0.26
R1181:Plekha2 UTSW 8 25059202 missense probably benign 0.26
R1668:Plekha2 UTSW 8 25072054 missense probably damaging 0.98
R1722:Plekha2 UTSW 8 25042960 missense probably benign 0.02
R2153:Plekha2 UTSW 8 25088397 missense probably damaging 1.00
R4223:Plekha2 UTSW 8 25043020 missense probably damaging 1.00
R4585:Plekha2 UTSW 8 25043669 nonsense probably null
R4604:Plekha2 UTSW 8 25059835 missense probably null 1.00
R4791:Plekha2 UTSW 8 25042762 missense probably damaging 1.00
R4817:Plekha2 UTSW 8 25059944 missense possibly damaging 0.94
R5344:Plekha2 UTSW 8 25043047 splice site probably null
R5670:Plekha2 UTSW 8 25059238 missense probably benign 0.03
R5892:Plekha2 UTSW 8 25052365 missense probably benign
R6440:Plekha2 UTSW 8 25088397 missense probably damaging 1.00
R7157:Plekha2 UTSW 8 25063941 missense probably damaging 1.00
R7242:Plekha2 UTSW 8 25088395 missense probably damaging 1.00
R7674:Plekha2 UTSW 8 25057298 missense probably damaging 1.00
R7810:Plekha2 UTSW 8 25088340 critical splice donor site probably null
R8048:Plekha2 UTSW 8 25063989 splice site probably benign
R8359:Plekha2 UTSW 8 25088391 missense probably damaging 1.00
X0027:Plekha2 UTSW 8 25057303 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTACATCCATGCCCACTG -3'
(R):5'- CTAGCCAGCATCATACTTTGGGG -3'

Sequencing Primer
(F):5'- TGGATCCCCAGCAGGAATAG -3'
(R):5'- GCATCATACTTTGGGGAAACAC -3'
Posted On 2018-11-28