Mutagenetix > Incidental Mutations

Incidental Mutation 'R6970:Tex15'

542187

Institutional Source

Beutler Lab

Gene Symbol

Tex15

Ensembl Gene

ENSMUSG00000009628

Gene Name

testis expressed gene 15

Synonyms

2210014E14Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene?

Possibly essential (E-score: 0.734) question?

Stock #

R6970 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33516738-33585582 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 33557428 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 178 (M178L)

Ref Sequence

ENSEMBL: ENSMUSP00000120744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124496] [ENSMUST00000124501] [ENSMUST00000149399]

Predicted Effect

probably benign
Transcript: ENSMUST00000124496
AA Change: M178L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628
AA Change: M178L

Domain	Start	End	E-Value	Type
Pfam:DUF3715	89	251	1.6e-58	PFAM
low complexity region	536	548	N/A	INTRINSIC
low complexity region	576	587	N/A	INTRINSIC
low complexity region	798	810	N/A	INTRINSIC
low complexity region	939	948	N/A	INTRINSIC
low complexity region	987	999	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124501
AA Change: M178L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628
AA Change: M178L

Domain	Start	End	E-Value	Type
Pfam:DUF3715	96	251	2.4e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149399

SMART Domains

Protein: ENSMUSP00000114474
Gene: ENSMUSG00000009628

Domain	Start	End	E-Value	Type
Pfam:DUF3715	89	148	2.9e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,112,314		probably null	Het
2410089E03Rik	T	C	15: 8,187,548	V750A	probably benign	Het
Acadsb	T	C	7: 131,434,315	Y285H	possibly damaging	Het
Adam17	A	G	12: 21,345,668	S285P	probably benign	Het
Adcy10	A	G	1: 165,556,916	N1082S	probably benign	Het
Ahdc1	T	A	4: 133,062,345	L299Q	possibly damaging	Het
Ambra1	T	A	2: 91,772,600		probably benign	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Atp8a1	A	G	5: 67,738,462	V543A	probably damaging	Het
BC034090	T	A	1: 155,241,439	D311V	probably damaging	Het
Blnk	G	T	19: 40,962,377	P110Q	probably damaging	Het
Cc2d2a	A	G	5: 43,718,585	E968G	probably damaging	Het
Ccdc14	A	T	16: 34,709,533	E394V	probably damaging	Het
Ccdc162	A	T	10: 41,615,958	H1086Q	probably benign	Het
Ccdc85b	T	A	19: 5,457,220	I60F	probably damaging	Het
Ceacam20	T	A	7: 19,989,977	L562Q	probably damaging	Het
Cntrl	T	C	2: 35,118,137	F188L	probably benign	Het
Dclk1	A	T	3: 55,466,601		probably benign	Het
Ddx20	A	T	3: 105,680,358	L434H	probably damaging	Het
Ddx51	G	A	5: 110,656,862	V547M	probably damaging	Het
Dnah11	T	A	12: 118,108,944	Q1472L	probably benign	Het
Dnajb13	T	C	7: 100,507,422	E149G	probably damaging	Het
Fat4	A	G	3: 38,981,775	N3192S	probably damaging	Het
Fat4	A	T	3: 38,995,971	D3994V	probably damaging	Het
Fcgr1	C	A	3: 96,284,620		probably null	Het
Gm11639	A	G	11: 104,776,356	E1422G	probably benign	Het
Gm12185	G	A	11: 48,907,912	R585*	probably null	Het
Gm32687	A	G	10: 81,879,470	H232R	probably benign	Het
Gm5431	G	T	11: 48,888,490	A535D	probably damaging	Het
Gm8300	G	T	12: 87,516,618		probably benign	Het
Gm906	A	T	13: 50,246,971	Y440N	possibly damaging	Het
Jarid2	C	T	13: 44,902,985	P556S	probably damaging	Het
Map3k4	C	A	17: 12,248,916	G1077V	probably damaging	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mlxip	A	G	5: 123,445,672	T433A	possibly damaging	Het
Mus81	G	T	19: 5,485,526	H199Q	probably benign	Het
Mylk3	G	A	8: 85,359,263	T54M	probably damaging	Het
Nalcn	A	G	14: 123,314,094	F1034L	possibly damaging	Het
Nfatc1	A	C	18: 80,667,013	S513A	probably benign	Het
Ninj2	A	G	6: 120,198,131	I88V	possibly damaging	Het
Nomo1	C	T	7: 46,045,967	P277L	probably damaging	Het
Nup214	C	T	2: 32,051,798	S571L	probably damaging	Het
Olfr1469	T	A	19: 13,411,428	N286K	probably damaging	Het
Olfr461	T	C	6: 40,544,656	S108G	probably benign	Het
Olfr980	T	A	9: 40,006,713	M79L	probably benign	Het
Pcdh15	C	T	10: 74,502,687	P1005S	probably damaging	Het
Pkhd1l1	G	A	15: 44,511,674	A942T	possibly damaging	Het
Plagl1	T	C	10: 13,125,116	C34R	probably damaging	Het
Plekha2	T	C	8: 25,059,264	Q168R	probably benign	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plekhm3	T	G	1: 64,892,753	K564T	possibly damaging	Het
Plpp2	A	G	10: 79,530,546	V26A	possibly damaging	Het
Prdm10	T	G	9: 31,329,823	Y302*	probably null	Het
Prdm8	A	G	5: 98,184,612	E124G	probably damaging	Het
Prg4	T	G	1: 150,455,906		probably benign	Het
Qser1	A	G	2: 104,788,130	V779A	probably benign	Het
Rbm39	G	A	2: 156,167,584	R123C	probably damaging	Het
Ric1	C	T	19: 29,587,772	P640S	probably damaging	Het
Rpl14	G	A	9: 120,574,227		probably benign	Het
Rsl1d1	T	A	16: 11,193,694	D382V	probably benign	Het
Rubcn	G	T	16: 32,868,144		probably benign	Het
Sec16a	G	A	2: 26,430,486	R1361C	probably damaging	Het
Slc26a11	T	G	11: 119,356,972	V41G	probably damaging	Het
Slc41a2	A	G	10: 83,316,096	F172L	possibly damaging	Het
Slc4a4	A	C	5: 89,179,831	Y674S	probably damaging	Het
Strc	A	C	2: 121,378,014	M292R	probably benign	Het
Syde2	A	G	3: 145,988,626	T210A	probably benign	Het
Tcf7l2	C	A	19: 55,755,048	A97E	probably benign	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tepsin	G	A	11: 120,095,364	T168M	probably damaging	Het
Tgfbr2	T	C	9: 116,110,051	N236S	probably damaging	Het
Tnrc18	A	G	5: 142,727,989	V2531A	probably damaging	Het
Ttn	T	G	2: 76,895,423		probably benign	Het
Tubgcp3	G	T	8: 12,637,000	D630E	probably damaging	Het
Ubr4	G	A	4: 139,406,528	W745*	probably null	Het
Vmn2r115	G	A	17: 23,346,015	G292D	probably benign	Het
Vmn2r38	T	A	7: 9,075,341	K681*	probably null	Het
Xrcc6	A	G	15: 82,031,174	K98E	probably benign	Het
Zfp423	A	G	8: 87,803,779	V13A	probably benign	Het
Zfp512b	A	G	2: 181,586,348	I5T	possibly damaging	Het
Zmynd8	C	T	2: 165,875,750	E14K	probably damaging	Het

Other mutations in Tex15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Tex15	APN	8	33575311	missense	probably benign	0.18
IGL00705:Tex15	APN	8	33581592	missense	probably damaging	1.00
IGL00820:Tex15	APN	8	33579006	splice site	probably benign
IGL01288:Tex15	APN	8	33571384	missense	probably benign	0.02
IGL01328:Tex15	APN	8	33571396	nonsense	probably null
IGL01359:Tex15	APN	8	33581898	missense	probably damaging	0.99
IGL01603:Tex15	APN	8	33573547	missense	possibly damaging	0.93
IGL01861:Tex15	APN	8	33570689	missense	probably damaging	1.00
IGL02052:Tex15	APN	8	33582465	missense	probably benign	0.28
IGL02560:Tex15	APN	8	33581751	missense	probably benign	0.00
IGL02677:Tex15	APN	8	33571080	missense	probably benign	0.03
IGL02739:Tex15	APN	8	33581693	missense	possibly damaging	0.68
Big_gulp	UTSW	8	33581734	missense	probably damaging	1.00
P0005:Tex15	UTSW	8	33570868	missense	probably benign	0.00
P0037:Tex15	UTSW	8	33581580	missense	probably benign	0.00
PIT4377001:Tex15	UTSW	8	33571101	missense	probably damaging	1.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0056:Tex15	UTSW	8	33582027	missense	probably benign	0.00
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0058:Tex15	UTSW	8	33581502	splice site	probably benign
R0595:Tex15	UTSW	8	33572617	missense	probably damaging	1.00
R0646:Tex15	UTSW	8	33582326	missense	possibly damaging	0.83
R0688:Tex15	UTSW	8	33573500	missense	probably damaging	1.00
R0842:Tex15	UTSW	8	33571547	missense	possibly damaging	0.95
R0987:Tex15	UTSW	8	33576847	missense	probably damaging	1.00
R1084:Tex15	UTSW	8	33577004	missense	probably benign	0.28
R1183:Tex15	UTSW	8	33574865	missense	probably benign	0.35
R1186:Tex15	UTSW	8	33571633	missense	probably benign	0.19
R1378:Tex15	UTSW	8	33575216	missense	probably damaging	0.99
R1500:Tex15	UTSW	8	33575092	missense	probably damaging	0.96
R1508:Tex15	UTSW	8	33576852	missense	probably damaging	1.00
R1597:Tex15	UTSW	8	33571483	missense	probably damaging	0.96
R1636:Tex15	UTSW	8	33576387	nonsense	probably null
R1639:Tex15	UTSW	8	33570817	missense	possibly damaging	0.94
R1809:Tex15	UTSW	8	33574234	missense	probably benign
R1843:Tex15	UTSW	8	33576654	missense	probably benign	0.27
R2029:Tex15	UTSW	8	33571274	missense	probably damaging	0.99
R2228:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2229:Tex15	UTSW	8	33571237	missense	probably benign	0.05
R2245:Tex15	UTSW	8	33571496	missense	possibly damaging	0.77
R2246:Tex15	UTSW	8	33582512	missense	possibly damaging	0.49
R2880:Tex15	UTSW	8	33574907	nonsense	probably null
R2881:Tex15	UTSW	8	33574907	nonsense	probably null
R2882:Tex15	UTSW	8	33574907	nonsense	probably null
R3001:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3002:Tex15	UTSW	8	33574528	missense	probably benign	0.15
R3020:Tex15	UTSW	8	33576670	missense	probably damaging	1.00
R3084:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3085:Tex15	UTSW	8	33574885	missense	probably benign	0.11
R3701:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3702:Tex15	UTSW	8	33574166	missense	probably benign	0.00
R3752:Tex15	UTSW	8	33571415	missense	probably benign
R4162:Tex15	UTSW	8	33581558	missense	probably damaging	1.00
R4231:Tex15	UTSW	8	33572137	missense	probably damaging	0.99
R4589:Tex15	UTSW	8	33557373	missense	probably damaging	1.00
R4707:Tex15	UTSW	8	33582497	missense	probably benign	0.00
R4773:Tex15	UTSW	8	33582732	missense	probably benign	0.42
R4967:Tex15	UTSW	8	33574470	missense	probably benign	0.34
R5063:Tex15	UTSW	8	33582610	missense	possibly damaging	0.59
R5121:Tex15	UTSW	8	33571766	missense	probably damaging	1.00
R5147:Tex15	UTSW	8	33572312	nonsense	probably null
R5166:Tex15	UTSW	8	33576392	missense	probably benign	0.07
R5173:Tex15	UTSW	8	33571740	missense	possibly damaging	0.73
R5439:Tex15	UTSW	8	33574171	missense	possibly damaging	0.93
R5537:Tex15	UTSW	8	33571613	missense	probably damaging	1.00
R5580:Tex15	UTSW	8	33572429	missense	probably damaging	1.00
R5588:Tex15	UTSW	8	33577187	missense	probably damaging	1.00
R5696:Tex15	UTSW	8	33573192	missense	probably benign	0.01
R5734:Tex15	UTSW	8	33546336	missense	probably benign	0.01
R5756:Tex15	UTSW	8	33575833	missense	probably benign	0.17
R5823:Tex15	UTSW	8	33570934	missense	possibly damaging	0.67
R6126:Tex15	UTSW	8	33573563	missense	probably benign	0.19
R6129:Tex15	UTSW	8	33574130	missense	possibly damaging	0.90
R6276:Tex15	UTSW	8	33577189	missense	possibly damaging	0.93
R6374:Tex15	UTSW	8	33575912	missense	probably damaging	1.00
R6430:Tex15	UTSW	8	33571301	missense	probably benign	0.01
R6452:Tex15	UTSW	8	33572816	missense	probably damaging	1.00
R6471:Tex15	UTSW	8	33581734	missense	probably damaging	1.00
R6700:Tex15	UTSW	8	33574889	missense	possibly damaging	0.93
R6918:Tex15	UTSW	8	33573184	missense	probably benign	0.27
R6958:Tex15	UTSW	8	33570871	missense	probably benign	0.01
R7059:Tex15	UTSW	8	33574730	missense	possibly damaging	0.57
R7069:Tex15	UTSW	8	33570720	missense	probably benign
R7072:Tex15	UTSW	8	33575431	missense	possibly damaging	0.85
R7212:Tex15	UTSW	8	33570826	nonsense	probably null
R7212:Tex15	UTSW	8	33572995	missense	probably damaging	1.00
R7216:Tex15	UTSW	8	33572986	missense	possibly damaging	0.93
R7219:Tex15	UTSW	8	33546240	missense	probably benign	0.40
R7313:Tex15	UTSW	8	33574817	missense	possibly damaging	0.82
R7315:Tex15	UTSW	8	33581516	missense	probably benign	0.01
R7444:Tex15	UTSW	8	33576562	missense	possibly damaging	0.92
R7455:Tex15	UTSW	8	33576997	missense	possibly damaging	0.91
R7643:Tex15	UTSW	8	33575120	missense	probably damaging	1.00
R7644:Tex15	UTSW	8	33574417	missense	probably benign	0.01
R7724:Tex15	UTSW	8	33546263	missense	possibly damaging	0.60
R7779:Tex15	UTSW	8	33575281	missense	probably damaging	1.00
R7798:Tex15	UTSW	8	33581847	missense	possibly damaging	0.69
R7816:Tex15	UTSW	8	33581655	missense	probably benign	0.14
R7820:Tex15	UTSW	8	33575062	missense	probably damaging	0.98
R8041:Tex15	UTSW	8	33575846	missense	probably damaging	1.00
R8150:Tex15	UTSW	8	33573506	missense	probably benign	0.06
R8152:Tex15	UTSW	8	33572893	missense	possibly damaging	0.82
R8237:Tex15	UTSW	8	33577399	missense	possibly damaging	0.72
R8250:Tex15	UTSW	8	33565205	missense	probably null	0.27
R8264:Tex15	UTSW	8	33582362	missense	probably benign	0.18
R8279:Tex15	UTSW	8	33571737	missense	probably damaging	0.96
R8353:Tex15	UTSW	8	33576871	nonsense	probably null
R8388:Tex15	UTSW	8	33575209	missense	probably benign	0.00
R8432:Tex15	UTSW	8	33576544	missense	probably damaging	0.99
R8453:Tex15	UTSW	8	33576871	nonsense	probably null
R8489:Tex15	UTSW	8	33577546	missense	probably benign	0.02
RF005:Tex15	UTSW	8	33576677	missense	probably benign	0.05
X0020:Tex15	UTSW	8	33576579	missense	probably benign	0.03
X0065:Tex15	UTSW	8	33575517	nonsense	probably null
Z1088:Tex15	UTSW	8	33571315	missense	possibly damaging	0.89
Z1088:Tex15	UTSW	8	33571810	missense	possibly damaging	0.68
Z1088:Tex15	UTSW	8	33574870	missense	probably benign
Z1176:Tex15	UTSW	8	33574726	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- ACGTAGGTCAGAGATGCGTG -3'
(R):5'- TTGTGCCATGTCAGATAGAGAG -3'

Sequencing Primer
(F):5'- GAAGAACATTTCTGCTTTCTGGCAC -3'
(R):5'- TGTGCCATGTCAGATAGAGAGTAAAG -3'

Posted On

2018-11-28