Mutagenetix > Incidental Mutations

Incidental Mutation 'R6970:Tenm3'

542188

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.523) question?

Stock #

R6970 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 48236439 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 2038 (D2038N)

Ref Sequence

ENSEMBL: ENSMUSP00000033965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000033965
AA Change: D2038N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: D2038N

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000190840
AA Change: D2022N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: D2022N

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,112,314		probably null	Het
2410089E03Rik	T	C	15: 8,187,548	V750A	probably benign	Het
Acadsb	T	C	7: 131,434,315	Y285H	possibly damaging	Het
Adam17	A	G	12: 21,345,668	S285P	probably benign	Het
Adcy10	A	G	1: 165,556,916	N1082S	probably benign	Het
Ahdc1	T	A	4: 133,062,345	L299Q	possibly damaging	Het
Ambra1	T	A	2: 91,772,600		probably benign	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Atp8a1	A	G	5: 67,738,462	V543A	probably damaging	Het
BC034090	T	A	1: 155,241,439	D311V	probably damaging	Het
Blnk	G	T	19: 40,962,377	P110Q	probably damaging	Het
Cc2d2a	A	G	5: 43,718,585	E968G	probably damaging	Het
Ccdc14	A	T	16: 34,709,533	E394V	probably damaging	Het
Ccdc162	A	T	10: 41,615,958	H1086Q	probably benign	Het
Ccdc85b	T	A	19: 5,457,220	I60F	probably damaging	Het
Ceacam20	T	A	7: 19,989,977	L562Q	probably damaging	Het
Cntrl	T	C	2: 35,118,137	F188L	probably benign	Het
Dclk1	A	T	3: 55,466,601		probably benign	Het
Ddx20	A	T	3: 105,680,358	L434H	probably damaging	Het
Ddx51	G	A	5: 110,656,862	V547M	probably damaging	Het
Dnah11	T	A	12: 118,108,944	Q1472L	probably benign	Het
Dnajb13	T	C	7: 100,507,422	E149G	probably damaging	Het
Fat4	A	G	3: 38,981,775	N3192S	probably damaging	Het
Fat4	A	T	3: 38,995,971	D3994V	probably damaging	Het
Fcgr1	C	A	3: 96,284,620		probably null	Het
Gm11639	A	G	11: 104,776,356	E1422G	probably benign	Het
Gm12185	G	A	11: 48,907,912	R585*	probably null	Het
Gm32687	A	G	10: 81,879,470	H232R	probably benign	Het
Gm5431	G	T	11: 48,888,490	A535D	probably damaging	Het
Gm8300	G	T	12: 87,516,618		probably benign	Het
Gm906	A	T	13: 50,246,971	Y440N	possibly damaging	Het
Jarid2	C	T	13: 44,902,985	P556S	probably damaging	Het
Map3k4	C	A	17: 12,248,916	G1077V	probably damaging	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mlxip	A	G	5: 123,445,672	T433A	possibly damaging	Het
Mus81	G	T	19: 5,485,526	H199Q	probably benign	Het
Mylk3	G	A	8: 85,359,263	T54M	probably damaging	Het
Nalcn	A	G	14: 123,314,094	F1034L	possibly damaging	Het
Nfatc1	A	C	18: 80,667,013	S513A	probably benign	Het
Ninj2	A	G	6: 120,198,131	I88V	possibly damaging	Het
Nomo1	C	T	7: 46,045,967	P277L	probably damaging	Het
Nup214	C	T	2: 32,051,798	S571L	probably damaging	Het
Olfr1469	T	A	19: 13,411,428	N286K	probably damaging	Het
Olfr461	T	C	6: 40,544,656	S108G	probably benign	Het
Olfr980	T	A	9: 40,006,713	M79L	probably benign	Het
Pcdh15	C	T	10: 74,502,687	P1005S	probably damaging	Het
Pkhd1l1	G	A	15: 44,511,674	A942T	possibly damaging	Het
Plagl1	T	C	10: 13,125,116	C34R	probably damaging	Het
Plekha2	T	C	8: 25,059,264	Q168R	probably benign	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plekhm3	T	G	1: 64,892,753	K564T	possibly damaging	Het
Plpp2	A	G	10: 79,530,546	V26A	possibly damaging	Het
Prdm10	T	G	9: 31,329,823	Y302*	probably null	Het
Prdm8	A	G	5: 98,184,612	E124G	probably damaging	Het
Prg4	T	G	1: 150,455,906		probably benign	Het
Qser1	A	G	2: 104,788,130	V779A	probably benign	Het
Rbm39	G	A	2: 156,167,584	R123C	probably damaging	Het
Ric1	C	T	19: 29,587,772	P640S	probably damaging	Het
Rpl14	G	A	9: 120,574,227		probably benign	Het
Rsl1d1	T	A	16: 11,193,694	D382V	probably benign	Het
Rubcn	G	T	16: 32,868,144		probably benign	Het
Sec16a	G	A	2: 26,430,486	R1361C	probably damaging	Het
Slc26a11	T	G	11: 119,356,972	V41G	probably damaging	Het
Slc41a2	A	G	10: 83,316,096	F172L	possibly damaging	Het
Slc4a4	A	C	5: 89,179,831	Y674S	probably damaging	Het
Strc	A	C	2: 121,378,014	M292R	probably benign	Het
Syde2	A	G	3: 145,988,626	T210A	probably benign	Het
Tcf7l2	C	A	19: 55,755,048	A97E	probably benign	Het
Tepsin	G	A	11: 120,095,364	T168M	probably damaging	Het
Tex15	A	T	8: 33,557,428	M178L	probably benign	Het
Tgfbr2	T	C	9: 116,110,051	N236S	probably damaging	Het
Tnrc18	A	G	5: 142,727,989	V2531A	probably damaging	Het
Ttn	T	G	2: 76,895,423		probably benign	Het
Tubgcp3	G	T	8: 12,637,000	D630E	probably damaging	Het
Ubr4	G	A	4: 139,406,528	W745*	probably null	Het
Vmn2r115	G	A	17: 23,346,015	G292D	probably benign	Het
Vmn2r38	T	A	7: 9,075,341	K681*	probably null	Het
Xrcc6	A	G	15: 82,031,174	K98E	probably benign	Het
Zfp423	A	G	8: 87,803,779	V13A	probably benign	Het
Zfp512b	A	G	2: 181,586,348	I5T	possibly damaging	Het
Zmynd8	C	T	2: 165,875,750	E14K	probably damaging	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0505:Tenm3	UTSW	8	48341160	splice site	probably benign
R0573:Tenm3	UTSW	8	48674399	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1473:Tenm3	UTSW	8	48310625	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1522:Tenm3	UTSW	8	48395576	missense	probably damaging	1.00
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1676:Tenm3	UTSW	8	48417119	missense	possibly damaging	0.83
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1768:Tenm3	UTSW	8	48232104	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6151:Tenm3	UTSW	8	48395573	missense	probably damaging	1.00
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6270:Tenm3	UTSW	8	48367394	missense	probably damaging	0.98
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7951:Tenm3	UTSW	8	48310703	missense	possibly damaging	0.86
R8293:Tenm3	UTSW	8	48367422	missense	possibly damaging	0.91
R8336:Tenm3	UTSW	8	48293773	missense	probably damaging	1.00
R8351:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8387:Tenm3	UTSW	8	48287848	missense	probably damaging	0.98
R8414:Tenm3	UTSW	8	48293509	missense	probably damaging	1.00
R8451:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8465:Tenm3	UTSW	8	48229181	missense	probably damaging	1.00
R8528:Tenm3	UTSW	8	48342633	missense	probably damaging	1.00
R8717:Tenm3	UTSW	8	48299645	missense	possibly damaging	0.77
R8734:Tenm3	UTSW	8	48349356	missense	probably benign	0.16
R8781:Tenm3	UTSW	8	48342449	frame shift	probably null
R8820:Tenm3	UTSW	8	48310724	missense	probably damaging	0.96
R8821:Tenm3	UTSW	8	48276382	missense
R8831:Tenm3	UTSW	8	48276382	missense
R8853:Tenm3	UTSW	8	48342347	missense	probably damaging	1.00
R8900:Tenm3	UTSW	8	48236402	missense	probably damaging	1.00
R8931:Tenm3	UTSW	8	48235602	missense	probably damaging	1.00
R8933:Tenm3	UTSW	8	48279060	missense	possibly damaging	0.53
R8989:Tenm3	UTSW	8	48235348	nonsense	probably null
R8998:Tenm3	UTSW	8	48276687	missense	probably damaging	1.00
R9008:Tenm3	UTSW	8	48342653	missense	probably damaging	0.98
R9017:Tenm3	UTSW	8	48254633	missense	probably damaging	0.99
R9101:Tenm3	UTSW	8	48292151	missense	probably damaging	1.00
R9108:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R9142:Tenm3	UTSW	8	48335513	missense	unknown
R9231:Tenm3	UTSW	8	48236196	missense	probably damaging	1.00
R9309:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R9310:Tenm3	UTSW	8	48555900	unclassified	probably benign
R9336:Tenm3	UTSW	8	48417080	missense	probably damaging	1.00
R9373:Tenm3	UTSW	8	48299655	missense	probably damaging	1.00
R9393:Tenm3	UTSW	8	48674524	missense	probably damaging	0.99
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCATGAGCATCAAAGTGC -3'
(R):5'- AGAAGGCAGACCAGGCTATC -3'

Sequencing Primer
(F):5'- GCTTTGTATAAGTCATCACGGCCG -3'
(R):5'- TACGACAGCACAAGAGTCAGTTTTAC -3'

Posted On

2018-11-28