Incidental Mutation 'R6970:Prdm10'
ID 542191
Institutional Source Beutler Lab
Gene Symbol Prdm10
Ensembl Gene ENSMUSG00000042496
Gene Name PR domain containing 10
Synonyms tristanin, LOC382066
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6970 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 31280538-31381723 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 31329823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 302 (Y302*)
Ref Sequence ENSEMBL: ENSMUSP00000149699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074510] [ENSMUST00000117389] [ENSMUST00000215499] [ENSMUST00000215847]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000074510
AA Change: Y253*
SMART Domains Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: Y253*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 111 117 N/A INTRINSIC
PDB:3IHX|D 133 284 1e-104 PDB
Blast:SET 165 277 3e-32 BLAST
ZnF_C2H2 300 322 5.42e-2 SMART
Pfam:Tristanin_u2 325 455 2.4e-49 PFAM
ZnF_C2H2 471 493 7.78e-3 SMART
ZnF_C2H2 501 523 1.95e-3 SMART
ZnF_C2H2 529 551 3.83e-2 SMART
ZnF_C2H2 557 580 8.34e-3 SMART
ZnF_C2H2 585 607 3.21e-4 SMART
ZnF_C2H2 613 636 3.69e-4 SMART
ZnF_C2H2 668 691 8.22e-2 SMART
ZnF_C2H2 801 824 1.25e-1 SMART
low complexity region 904 916 N/A INTRINSIC
low complexity region 956 964 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1110 1122 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117389
AA Change: Y302*
SMART Domains Protein: ENSMUSP00000112588
Gene: ENSMUSG00000042496
AA Change: Y302*

DomainStartEndE-ValueType
coiled coil region 119 150 N/A INTRINSIC
PDB:3IHX|D 182 317 2e-97 PDB
Blast:SET 214 317 2e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000215499
AA Change: Y284*
Predicted Effect probably null
Transcript: ENSMUST00000215847
AA Change: Y302*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Prdm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Prdm10 APN 9 31360812 splice site probably benign
IGL00485:Prdm10 APN 9 31327546 missense possibly damaging 0.87
IGL00757:Prdm10 APN 9 31318546 missense possibly damaging 0.69
IGL00836:Prdm10 APN 9 31329869 splice site probably benign
IGL01505:Prdm10 APN 9 31327282 missense probably benign
IGL01594:Prdm10 APN 9 31346853 missense probably damaging 1.00
IGL01894:Prdm10 APN 9 31316261 missense probably damaging 1.00
IGL01927:Prdm10 APN 9 31335398 splice site probably benign
IGL02053:Prdm10 APN 9 31360848 missense probably benign 0.00
IGL02068:Prdm10 APN 9 31337350 missense probably damaging 1.00
IGL02295:Prdm10 APN 9 31362368 missense probably benign
IGL02390:Prdm10 APN 9 31353389 missense possibly damaging 0.68
IGL02574:Prdm10 APN 9 31357293 missense probably damaging 1.00
IGL02636:Prdm10 APN 9 31329681 missense possibly damaging 0.68
IGL02883:Prdm10 APN 9 31327348 missense probably damaging 0.99
IGL03057:Prdm10 APN 9 31349185 missense probably damaging 1.00
PIT4142001:Prdm10 UTSW 9 31325767 missense probably benign 0.00
R0089:Prdm10 UTSW 9 31316230 missense probably damaging 1.00
R0149:Prdm10 UTSW 9 31316159 splice site probably benign
R0306:Prdm10 UTSW 9 31316224 missense probably damaging 1.00
R0386:Prdm10 UTSW 9 31316300 missense probably damaging 1.00
R0390:Prdm10 UTSW 9 31349268 critical splice donor site probably null
R1512:Prdm10 UTSW 9 31337401 missense probably damaging 1.00
R1528:Prdm10 UTSW 9 31357286 missense probably damaging 1.00
R2409:Prdm10 UTSW 9 31349122 missense possibly damaging 0.81
R3745:Prdm10 UTSW 9 31340407 missense possibly damaging 0.72
R3929:Prdm10 UTSW 9 31347136 missense probably damaging 1.00
R4295:Prdm10 UTSW 9 31316294 missense possibly damaging 0.94
R4629:Prdm10 UTSW 9 31337316 nonsense probably null
R4660:Prdm10 UTSW 9 31327328 missense probably damaging 1.00
R4758:Prdm10 UTSW 9 31362412 missense probably benign 0.00
R4793:Prdm10 UTSW 9 31353405 missense probably damaging 1.00
R4798:Prdm10 UTSW 9 31341273 missense probably damaging 1.00
R4806:Prdm10 UTSW 9 31329941 makesense probably null
R4865:Prdm10 UTSW 9 31347080 missense probably damaging 1.00
R5068:Prdm10 UTSW 9 31359047 missense probably damaging 0.96
R5093:Prdm10 UTSW 9 31341483 missense probably damaging 1.00
R5162:Prdm10 UTSW 9 31340418 missense possibly damaging 0.90
R5656:Prdm10 UTSW 9 31353417 missense probably benign 0.08
R5855:Prdm10 UTSW 9 31337323 missense probably damaging 1.00
R6242:Prdm10 UTSW 9 31341252 missense possibly damaging 0.67
R6396:Prdm10 UTSW 9 31318546 missense possibly damaging 0.69
R7165:Prdm10 UTSW 9 31316442 splice site probably null
R7177:Prdm10 UTSW 9 31367707 missense probably benign
R7201:Prdm10 UTSW 9 31316306 missense possibly damaging 0.87
R7313:Prdm10 UTSW 9 31357160 nonsense probably null
R7337:Prdm10 UTSW 9 31316241 missense probably damaging 1.00
R7511:Prdm10 UTSW 9 31378481 missense probably damaging 1.00
R7711:Prdm10 UTSW 9 31357232 missense probably damaging 1.00
R7855:Prdm10 UTSW 9 31327474 missense probably benign 0.04
R7965:Prdm10 UTSW 9 31347006 missense probably damaging 1.00
R7997:Prdm10 UTSW 9 31353425 missense probably damaging 1.00
R8168:Prdm10 UTSW 9 31346967 missense probably benign 0.00
R8717:Prdm10 UTSW 9 31341399 missense probably benign 0.31
R8865:Prdm10 UTSW 9 31327397 missense probably damaging 1.00
R8880:Prdm10 UTSW 9 31353446 missense probably damaging 1.00
R9022:Prdm10 UTSW 9 31357128 missense probably benign 0.01
R9200:Prdm10 UTSW 9 31357142 missense probably damaging 1.00
R9288:Prdm10 UTSW 9 31341378 missense possibly damaging 0.67
RF004:Prdm10 UTSW 9 31359126 missense probably damaging 1.00
X0064:Prdm10 UTSW 9 31362451 missense probably damaging 1.00
Z1176:Prdm10 UTSW 9 31316168 missense possibly damaging 0.95
Z1176:Prdm10 UTSW 9 31316293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCTTTGGTTACAGGTTTCTCTTGA -3'
(R):5'- GGTTCCACCAACAACAGAGTGA -3'

Sequencing Primer
(F):5'- CAGGTTTCTCTTGATAAAGGAGACAG -3'
(R):5'- GACATGCATGGGCTCTATGCATAC -3'
Posted On 2018-11-28