Incidental Mutation 'R6970:Olfr980'
ID542192
Institutional Source Beutler Lab
Gene Symbol Olfr980
Ensembl Gene ENSMUSG00000060254
Gene Nameolfactory receptor 980
SynonymsMOR223-2, GA_x6K02T2PVTD-33705428-33704496
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6970 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location40004348-40009582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40006713 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 79 (M79L)
Ref Sequence ENSEMBL: ENSMUSP00000150496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073932] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably benign
Transcript: ENSMUST00000073932
AA Change: M79L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091386
Gene: ENSMUSG00000060254
AA Change: M79L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.4e-55 PFAM
Pfam:7tm_1 39 287 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215523
Predicted Effect probably benign
Transcript: ENSMUST00000216463
AA Change: M79L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Olfr980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02256:Olfr980 APN 9 40006053 missense probably benign
IGL02378:Olfr980 APN 9 40006473 missense probably damaging 1.00
IGL03384:Olfr980 APN 9 40006470 missense probably benign
IGL03402:Olfr980 APN 9 40006506 missense probably benign 0.31
PIT4651001:Olfr980 UTSW 9 40006230 missense probably damaging 0.97
R0013:Olfr980 UTSW 9 40006355 missense probably damaging 1.00
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R4541:Olfr980 UTSW 9 40006293 missense possibly damaging 0.95
R4562:Olfr980 UTSW 9 40006281 missense probably damaging 0.99
R4731:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4732:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4733:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4825:Olfr980 UTSW 9 40006742 missense possibly damaging 0.72
R5619:Olfr980 UTSW 9 40006743 missense probably benign 0.07
R5770:Olfr980 UTSW 9 40006338 missense probably benign 0.01
R5791:Olfr980 UTSW 9 40006734 missense probably damaging 1.00
R6813:Olfr980 UTSW 9 40006457 missense probably benign
R6819:Olfr980 UTSW 9 40006548 missense probably benign 0.00
R7490:Olfr980 UTSW 9 40006424 missense probably damaging 1.00
R7511:Olfr980 UTSW 9 40006933 missense possibly damaging 0.63
Z1088:Olfr980 UTSW 9 40006596 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTAGTCTGGACAGCAGAGTG -3'
(R):5'- ACTCCATGCTCTTTGGGATC -3'

Sequencing Primer
(F):5'- GGAACCAGTGATCCATGTTCCTG -3'
(R):5'- CATGCTCTTTGGGATCTTCCTTGTG -3'
Posted On2018-11-28