Incidental Mutation 'R6970:Tgfbr2'
ID542193
Institutional Source Beutler Lab
Gene Symbol Tgfbr2
Ensembl Gene ENSMUSG00000032440
Gene Nametransforming growth factor, beta receptor II
SynonymsTbetaR-II, TBR-II, TbetaRII, 1110020H15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6970 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location116084293-116175360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116110051 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 236 (N236S)
Ref Sequence ENSEMBL: ENSMUSP00000035014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035014] [ENSMUST00000061101]
Predicted Effect probably damaging
Transcript: ENSMUST00000035014
AA Change: N236S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035014
Gene: ENSMUSG00000032440
AA Change: N236S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ecTbetaR2 47 165 1.8e-55 PFAM
Pfam:Pkinase 244 538 9.9e-52 PFAM
Pfam:Pkinase_Tyr 244 538 2.9e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000061101
AA Change: N261S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062333
Gene: ENSMUSG00000032440
AA Change: N261S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ecTbetaR2 74 184 4.6e-45 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Pfam:Pkinase 269 563 2.7e-36 PFAM
Pfam:Pkinase_Tyr 269 563 5e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die in midgestation with impaired yolk sac hematopoiesis and vasculogenesis. Selective knockouts in bone marrow cells and cranial neural crest show inflammation and cleft palate/calvarial defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Tgfbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tgfbr2 APN 9 116110189 missense probably damaging 0.99
IGL00484:Tgfbr2 APN 9 116158289 missense probably benign 0.00
IGL01010:Tgfbr2 APN 9 116129980 missense possibly damaging 0.80
IGL01656:Tgfbr2 APN 9 116109669 missense probably damaging 1.00
IGL02496:Tgfbr2 APN 9 116090418 missense probably benign 0.13
IGL02550:Tgfbr2 APN 9 116110129 missense probably benign
IGL02563:Tgfbr2 APN 9 116129998 missense probably benign 0.10
IGL03403:Tgfbr2 APN 9 116110302 missense probably benign
IGL02799:Tgfbr2 UTSW 9 116110136 missense possibly damaging 0.50
R0617:Tgfbr2 UTSW 9 116158320 missense probably benign 0.00
R1483:Tgfbr2 UTSW 9 116109557 missense probably benign 0.04
R1776:Tgfbr2 UTSW 9 116174967 missense possibly damaging 0.94
R1777:Tgfbr2 UTSW 9 116109880 missense probably damaging 0.99
R1831:Tgfbr2 UTSW 9 116090536 missense possibly damaging 0.74
R2323:Tgfbr2 UTSW 9 116110144 missense possibly damaging 0.90
R2378:Tgfbr2 UTSW 9 116129950 missense probably benign 0.02
R3123:Tgfbr2 UTSW 9 116110069 missense possibly damaging 0.95
R3418:Tgfbr2 UTSW 9 116129833 missense probably damaging 1.00
R3605:Tgfbr2 UTSW 9 116109892 missense probably benign 0.03
R4039:Tgfbr2 UTSW 9 116175037 start codon destroyed probably null 0.62
R4191:Tgfbr2 UTSW 9 116109941 missense probably damaging 1.00
R4193:Tgfbr2 UTSW 9 116109941 missense probably damaging 1.00
R4945:Tgfbr2 UTSW 9 116131565 missense probably benign
R5431:Tgfbr2 UTSW 9 116131601 missense probably damaging 0.99
R5714:Tgfbr2 UTSW 9 116175024 missense probably damaging 0.98
R5964:Tgfbr2 UTSW 9 116110255 missense possibly damaging 0.64
R6180:Tgfbr2 UTSW 9 116110144 missense possibly damaging 0.90
R7228:Tgfbr2 UTSW 9 116109943 missense probably damaging 1.00
R7258:Tgfbr2 UTSW 9 116129830 missense probably damaging 0.98
R7315:Tgfbr2 UTSW 9 116109738 missense possibly damaging 0.49
R8171:Tgfbr2 UTSW 9 116130006 nonsense probably null
R8175:Tgfbr2 UTSW 9 116109955 missense possibly damaging 0.92
R8417:Tgfbr2 UTSW 9 116110129 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGTTGATATCGGAGAAGATGTC -3'
(R):5'- TTATCCAAGTGACGGGTGTC -3'

Sequencing Primer
(F):5'- CCTTCTCTGTTTTCCACGAGGAG -3'
(R):5'- TCCGCTGGGGATTGCCATAG -3'
Posted On2018-11-28