Incidental Mutation 'R6970:Plagl1'
ID 542195
Institutional Source Beutler Lab
Gene Symbol Plagl1
Ensembl Gene ENSMUSG00000019817
Gene Name pleiomorphic adenoma gene-like 1
Synonyms Zac1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R6970 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 13060504-13131694 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13125116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 34 (C34R)
Ref Sequence ENSEMBL: ENSMUSP00000141514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121325] [ENSMUST00000121646] [ENSMUST00000121766] [ENSMUST00000130313] [ENSMUST00000143582] [ENSMUST00000145103] [ENSMUST00000193426]
AlphaFold Q9JLQ4
Predicted Effect probably damaging
Transcript: ENSMUST00000121325
AA Change: C34R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112889
Gene: ENSMUSG00000019817
AA Change: C34R

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121646
AA Change: C34R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112847
Gene: ENSMUSG00000019817
AA Change: C34R

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121766
AA Change: C34R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113710
Gene: ENSMUSG00000019817
AA Change: C34R

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
ZnF_C2H2 120 142 6.57e0 SMART
ZnF_C2H2 156 178 6.32e-3 SMART
ZnF_C2H2 184 207 1.25e-1 SMART
low complexity region 270 385 N/A INTRINSIC
coiled coil region 640 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130313
AA Change: C34R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117321
Gene: ENSMUSG00000019817
AA Change: C34R

DomainStartEndE-ValueType
ZnF_C2H2 4 26 2.36e-2 SMART
ZnF_C2H2 32 56 7.9e-4 SMART
ZnF_C2H2 62 84 2.95e-3 SMART
ZnF_C2H2 91 113 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143582
Predicted Effect probably benign
Transcript: ENSMUST00000145103
Predicted Effect probably damaging
Transcript: ENSMUST00000193426
AA Change: C34R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141514
Gene: ENSMUSG00000019817
AA Change: C34R

DomainStartEndE-ValueType
ZnF_C2H2 4 26 1e-4 SMART
ZnF_C2H2 32 56 3.2e-6 SMART
ZnF_C2H2 62 84 1.3e-5 SMART
ZnF_C2H2 91 113 1.1e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice exhibit significantly reduced birth weights. Heterozygous mice with a paternal copy of the null allele show reduced fetal and birth weights, altered ossification, dyspnea and background-dependent neonatal lethality, as well as wrinkled skin and curly tails with 30% penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Plagl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Plagl1 APN 10 13127872 unclassified probably benign
R0554:Plagl1 UTSW 10 13127182 missense probably benign 0.07
R0842:Plagl1 UTSW 10 13128554 unclassified probably benign
R0967:Plagl1 UTSW 10 13128242 unclassified probably benign
R1610:Plagl1 UTSW 10 13128962 unclassified probably benign
R2002:Plagl1 UTSW 10 13128658 unclassified probably benign
R2107:Plagl1 UTSW 10 13128647 unclassified probably benign
R2108:Plagl1 UTSW 10 13128647 unclassified probably benign
R2191:Plagl1 UTSW 10 13128941 unclassified probably benign
R4061:Plagl1 UTSW 10 13128771 unclassified probably benign
R4062:Plagl1 UTSW 10 13128771 unclassified probably benign
R4631:Plagl1 UTSW 10 13127999 unclassified probably benign
R4924:Plagl1 UTSW 10 13127557 missense possibly damaging 0.85
R5071:Plagl1 UTSW 10 13127261 missense probably damaging 1.00
R5138:Plagl1 UTSW 10 13128175 unclassified probably benign
R5893:Plagl1 UTSW 10 13128194 unclassified probably benign
R5971:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6061:Plagl1 UTSW 10 13127895 unclassified probably benign
R6138:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
R6170:Plagl1 UTSW 10 13127231 missense probably damaging 1.00
R6625:Plagl1 UTSW 10 13128062 unclassified probably benign
R7035:Plagl1 UTSW 10 13128233 unclassified probably benign
R8265:Plagl1 UTSW 10 13128881 missense unknown
R9145:Plagl1 UTSW 10 13128128 missense unknown
U15987:Plagl1 UTSW 10 13127746 missense probably damaging 1.00
Z1176:Plagl1 UTSW 10 13128716 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCTGGGCTTAAATGGCAC -3'
(R):5'- CCATGGTCATCAATGGCATACC -3'

Sequencing Primer
(F):5'- TGGCACAGCAGTTCCTCAG -3'
(R):5'- CTGACAATAGGGCTTTAAAGAGTGCC -3'
Posted On 2018-11-28