Mutagenetix > Incidental Mutations

Incidental Mutation 'R6970:Map3k4'

542219

Institutional Source

Beutler Lab

Gene Symbol

Map3k4

Ensembl Gene

ENSMUSG00000014426

Gene Name

mitogen-activated protein kinase kinase kinase 4

Synonyms

D17Rp17, D17Rp17e, RP17, MAPKKK4, Mekk4, MTK1, Tas

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R6970 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12227621-12318660 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 12248916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Valine at position 1077 (G1077V)

Ref Sequence

ENSEMBL: ENSMUSP00000086459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089058]

AlphaFold

O08648

Predicted Effect

probably damaging
Transcript: ENSMUST00000089058
AA Change: G1077V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: G1077V

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
low complexity region	27	43	N/A	INTRINSIC
low complexity region	215	235	N/A	INTRINSIC
low complexity region	432	462	N/A	INTRINSIC
low complexity region	1177	1191	N/A	INTRINSIC
S_TKc	1332	1590	1.41e-91	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,112,314		probably null	Het
2410089E03Rik	T	C	15: 8,187,548	V750A	probably benign	Het
Acadsb	T	C	7: 131,434,315	Y285H	possibly damaging	Het
Adam17	A	G	12: 21,345,668	S285P	probably benign	Het
Adcy10	A	G	1: 165,556,916	N1082S	probably benign	Het
Ahdc1	T	A	4: 133,062,345	L299Q	possibly damaging	Het
Ambra1	T	A	2: 91,772,600		probably benign	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Atp8a1	A	G	5: 67,738,462	V543A	probably damaging	Het
BC034090	T	A	1: 155,241,439	D311V	probably damaging	Het
Blnk	G	T	19: 40,962,377	P110Q	probably damaging	Het
Cc2d2a	A	G	5: 43,718,585	E968G	probably damaging	Het
Ccdc14	A	T	16: 34,709,533	E394V	probably damaging	Het
Ccdc162	A	T	10: 41,615,958	H1086Q	probably benign	Het
Ccdc85b	T	A	19: 5,457,220	I60F	probably damaging	Het
Ceacam20	T	A	7: 19,989,977	L562Q	probably damaging	Het
Cntrl	T	C	2: 35,118,137	F188L	probably benign	Het
Dclk1	A	T	3: 55,466,601		probably benign	Het
Ddx20	A	T	3: 105,680,358	L434H	probably damaging	Het
Ddx51	G	A	5: 110,656,862	V547M	probably damaging	Het
Dnah11	T	A	12: 118,108,944	Q1472L	probably benign	Het
Dnajb13	T	C	7: 100,507,422	E149G	probably damaging	Het
Fat4	A	G	3: 38,981,775	N3192S	probably damaging	Het
Fat4	A	T	3: 38,995,971	D3994V	probably damaging	Het
Fcgr1	C	A	3: 96,284,620		probably null	Het
Gm11639	A	G	11: 104,776,356	E1422G	probably benign	Het
Gm12185	G	A	11: 48,907,912	R585*	probably null	Het
Gm32687	A	G	10: 81,879,470	H232R	probably benign	Het
Gm5431	G	T	11: 48,888,490	A535D	probably damaging	Het
Gm8300	G	T	12: 87,516,618		probably benign	Het
Gm906	A	T	13: 50,246,971	Y440N	possibly damaging	Het
Jarid2	C	T	13: 44,902,985	P556S	probably damaging	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mlxip	A	G	5: 123,445,672	T433A	possibly damaging	Het
Mus81	G	T	19: 5,485,526	H199Q	probably benign	Het
Mylk3	G	A	8: 85,359,263	T54M	probably damaging	Het
Nalcn	A	G	14: 123,314,094	F1034L	possibly damaging	Het
Nfatc1	A	C	18: 80,667,013	S513A	probably benign	Het
Ninj2	A	G	6: 120,198,131	I88V	possibly damaging	Het
Nomo1	C	T	7: 46,045,967	P277L	probably damaging	Het
Nup214	C	T	2: 32,051,798	S571L	probably damaging	Het
Olfr1469	T	A	19: 13,411,428	N286K	probably damaging	Het
Olfr461	T	C	6: 40,544,656	S108G	probably benign	Het
Olfr980	T	A	9: 40,006,713	M79L	probably benign	Het
Pcdh15	C	T	10: 74,502,687	P1005S	probably damaging	Het
Pkhd1l1	G	A	15: 44,511,674	A942T	possibly damaging	Het
Plagl1	T	C	10: 13,125,116	C34R	probably damaging	Het
Plekha2	T	C	8: 25,059,264	Q168R	probably benign	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plekhm3	T	G	1: 64,892,753	K564T	possibly damaging	Het
Plpp2	A	G	10: 79,530,546	V26A	possibly damaging	Het
Prdm10	T	G	9: 31,329,823	Y302*	probably null	Het
Prdm8	A	G	5: 98,184,612	E124G	probably damaging	Het
Prg4	T	G	1: 150,455,906		probably benign	Het
Qser1	A	G	2: 104,788,130	V779A	probably benign	Het
Rbm39	G	A	2: 156,167,584	R123C	probably damaging	Het
Ric1	C	T	19: 29,587,772	P640S	probably damaging	Het
Rpl14	G	A	9: 120,574,227		probably benign	Het
Rsl1d1	T	A	16: 11,193,694	D382V	probably benign	Het
Rubcn	G	T	16: 32,868,144		probably benign	Het
Sec16a	G	A	2: 26,430,486	R1361C	probably damaging	Het
Slc26a11	T	G	11: 119,356,972	V41G	probably damaging	Het
Slc41a2	A	G	10: 83,316,096	F172L	possibly damaging	Het
Slc4a4	A	C	5: 89,179,831	Y674S	probably damaging	Het
Strc	A	C	2: 121,378,014	M292R	probably benign	Het
Syde2	A	G	3: 145,988,626	T210A	probably benign	Het
Tcf7l2	C	A	19: 55,755,048	A97E	probably benign	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tepsin	G	A	11: 120,095,364	T168M	probably damaging	Het
Tex15	A	T	8: 33,557,428	M178L	probably benign	Het
Tgfbr2	T	C	9: 116,110,051	N236S	probably damaging	Het
Tnrc18	A	G	5: 142,727,989	V2531A	probably damaging	Het
Ttn	T	G	2: 76,895,423		probably benign	Het
Tubgcp3	G	T	8: 12,637,000	D630E	probably damaging	Het
Ubr4	G	A	4: 139,406,528	W745*	probably null	Het
Vmn2r115	G	A	17: 23,346,015	G292D	probably benign	Het
Vmn2r38	T	A	7: 9,075,341	K681*	probably null	Het
Xrcc6	A	G	15: 82,031,174	K98E	probably benign	Het
Zfp423	A	G	8: 87,803,779	V13A	probably benign	Het
Zfp512b	A	G	2: 181,586,348	I5T	possibly damaging	Het
Zmynd8	C	T	2: 165,875,750	E14K	probably damaging	Het

Other mutations in Map3k4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Map3k4	APN	17	12232990	missense	probably damaging	1.00
IGL01124:Map3k4	APN	17	12255200	missense	probably benign	0.01
IGL01125:Map3k4	APN	17	12271962	missense	probably damaging	0.96
IGL01585:Map3k4	APN	17	12248959	missense	probably damaging	1.00
IGL02194:Map3k4	APN	17	12248995	missense	probably benign	0.30
IGL02194:Map3k4	APN	17	12263928	missense	probably damaging	1.00
IGL02292:Map3k4	APN	17	12235158	missense	possibly damaging	0.77
IGL02326:Map3k4	APN	17	12249010	missense	probably damaging	1.00
IGL02388:Map3k4	APN	17	12271610	missense	probably damaging	0.99
IGL02621:Map3k4	APN	17	12264013	missense	probably damaging	1.00
IGL02668:Map3k4	APN	17	12235953	missense	possibly damaging	0.85
IGL02850:Map3k4	APN	17	12271914	missense	probably damaging	1.00
IGL02939:Map3k4	APN	17	12272149	missense	probably damaging	1.00
IGL03148:Map3k4	APN	17	12238158	missense	probably benign	0.01
IGL03238:Map3k4	APN	17	12271158	missense	probably benign	0.10
ANU74:Map3k4	UTSW	17	12232976	missense	probably damaging	1.00
R0012:Map3k4	UTSW	17	12238189	missense	probably damaging	1.00
R0012:Map3k4	UTSW	17	12238189	missense	probably damaging	1.00
R0128:Map3k4	UTSW	17	12248063	missense	probably damaging	0.99
R0183:Map3k4	UTSW	17	12235128	missense	probably damaging	1.00
R0309:Map3k4	UTSW	17	12271015	frame shift	probably null
R0355:Map3k4	UTSW	17	12254171	missense	probably damaging	1.00
R0367:Map3k4	UTSW	17	12258041	splice site	probably benign
R1103:Map3k4	UTSW	17	12237063	splice site	probably null
R1446:Map3k4	UTSW	17	12256794	nonsense	probably null
R1542:Map3k4	UTSW	17	12235906	missense	probably damaging	0.97
R1713:Map3k4	UTSW	17	12249571	missense	probably benign	0.39
R1777:Map3k4	UTSW	17	12271730	missense	possibly damaging	0.82
R1797:Map3k4	UTSW	17	12264019	missense	probably benign	0.30
R1997:Map3k4	UTSW	17	12254995	critical splice donor site	probably null
R2042:Map3k4	UTSW	17	12277983	missense	probably damaging	0.99
R2878:Map3k4	UTSW	17	12264067	missense	probably benign	0.00
R2939:Map3k4	UTSW	17	12261270	missense	probably damaging	0.98
R2940:Map3k4	UTSW	17	12261270	missense	probably damaging	0.98
R3405:Map3k4	UTSW	17	12256781	missense	probably damaging	1.00
R3930:Map3k4	UTSW	17	12235993	missense	possibly damaging	0.83
R4291:Map3k4	UTSW	17	12255260	missense	probably benign	0.08
R4410:Map3k4	UTSW	17	12248998	missense	probably damaging	1.00
R4632:Map3k4	UTSW	17	12232504	missense	probably damaging	1.00
R4641:Map3k4	UTSW	17	12264045	missense	probably damaging	1.00
R4726:Map3k4	UTSW	17	12232964	missense	possibly damaging	0.89
R4730:Map3k4	UTSW	17	12248974	missense	probably damaging	0.99
R4832:Map3k4	UTSW	17	12271780	missense	probably damaging	1.00
R4896:Map3k4	UTSW	17	12272019	missense	possibly damaging	0.65
R4934:Map3k4	UTSW	17	12271900	missense	probably damaging	1.00
R4971:Map3k4	UTSW	17	12249495	critical splice donor site	probably null
R4980:Map3k4	UTSW	17	12272071	missense	probably damaging	1.00
R5211:Map3k4	UTSW	17	12232434	missense	possibly damaging	0.88
R5337:Map3k4	UTSW	17	12271610	missense	probably damaging	0.99
R5356:Map3k4	UTSW	17	12247308	missense	possibly damaging	0.87
R5550:Map3k4	UTSW	17	12243558	nonsense	probably null
R5824:Map3k4	UTSW	17	12229639	missense	probably damaging	1.00
R5890:Map3k4	UTSW	17	12271416	missense	probably damaging	1.00
R6285:Map3k4	UTSW	17	12264058	missense	probably damaging	1.00
R6380:Map3k4	UTSW	17	12272067	missense	possibly damaging	0.56
R6383:Map3k4	UTSW	17	12249583	missense	possibly damaging	0.82
R6571:Map3k4	UTSW	17	12242692	missense	possibly damaging	0.80
R6584:Map3k4	UTSW	17	12260491	missense	probably damaging	1.00
R6616:Map3k4	UTSW	17	12271344	missense	probably damaging	1.00
R6644:Map3k4	UTSW	17	12232410	critical splice donor site	probably null
R6909:Map3k4	UTSW	17	12270985	missense	probably damaging	1.00
R6947:Map3k4	UTSW	17	12260569	nonsense	probably null
R7120:Map3k4	UTSW	17	12271467	missense	probably damaging	1.00
R7253:Map3k4	UTSW	17	12272068	missense	probably benign	0.00
R7267:Map3k4	UTSW	17	12271649	nonsense	probably null
R7322:Map3k4	UTSW	17	12270946	missense	probably damaging	1.00
R7522:Map3k4	UTSW	17	12261332	missense	probably benign	0.39
R7554:Map3k4	UTSW	17	12232413	missense	probably damaging	1.00
R7554:Map3k4	UTSW	17	12232414	nonsense	probably null
R7681:Map3k4	UTSW	17	12318543	missense	unknown
R7734:Map3k4	UTSW	17	12264111	missense	probably damaging	1.00
R7842:Map3k4	UTSW	17	12271143	missense	possibly damaging	0.54
R8013:Map3k4	UTSW	17	12271031	nonsense	probably null
R8014:Map3k4	UTSW	17	12271031	nonsense	probably null
R8235:Map3k4	UTSW	17	12240081	splice site	probably null
R8294:Map3k4	UTSW	17	12318613	missense	unknown
R8528:Map3k4	UTSW	17	12232934	missense	probably damaging	1.00
R8858:Map3k4	UTSW	17	12271872	missense	probably damaging	1.00
R8924:Map3k4	UTSW	17	12271546	missense	probably benign	0.00
R9063:Map3k4	UTSW	17	12263991	missense	probably damaging	1.00
R9224:Map3k4	UTSW	17	12238086	missense	probably damaging	0.99
X0067:Map3k4	UTSW	17	12264094	missense	probably benign	0.03
Z1177:Map3k4	UTSW	17	12271697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCCTCCAAGGTTAGTTCCAG -3'
(R):5'- GCAGTTCAGTTTTAGGAAAAGGC -3'

Sequencing Primer
(F):5'- AGTTCCAGGCGTCACGTATAC -3'
(R):5'- ATTGTGTGTAGCTATTGCCAGAAC -3'

Posted On

2018-11-28