Mutagenetix > Incidental Mutations

Incidental Mutation 'R6970:Nfatc1'

542221

Institutional Source

Beutler Lab

Gene Symbol

Nfatc1

Ensembl Gene

ENSMUSG00000033016

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1

Synonyms

NFATc, NFAT2, 2210017P03Rik, NF-ATc

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6970 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80606205-80713071 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 80667013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 513 (S513A)

Ref Sequence

ENSEMBL: ENSMUSP00000129001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035800] [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035800
AA Change: S499A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000046312
Gene: ENSMUSG00000033016
AA Change: S499A

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	156	188	N/A	INTRINSIC
low complexity region	263	279	N/A	INTRINSIC
Pfam:RHD	415	575	7.4e-28	PFAM
IPT	582	681	8.99e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000078049
AA Change: S513A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016
AA Change: S513A

Domain	Start	End	E-Value	Type
low complexity region	170	202	N/A	INTRINSIC
low complexity region	277	293	N/A	INTRINSIC
Pfam:RHD	429	589	1.3e-27	PFAM
IPT	596	695	8.99e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167977
AA Change: S499A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: S499A

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	156	188	N/A	INTRINSIC
low complexity region	263	279	N/A	INTRINSIC
Pfam:RHD	415	575	4.9e-28	PFAM
IPT	582	681	8.99e-21	SMART
low complexity region	832	841	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170905
AA Change: S513A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: S513A

Domain	Start	End	E-Value	Type
low complexity region	170	202	N/A	INTRINSIC
low complexity region	277	293	N/A	INTRINSIC
Pfam:RHD_DNA_bind	429	589	5.1e-28	PFAM
IPT	596	695	8.99e-21	SMART
low complexity region	846	855	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	G	19: 11,112,314		probably null	Het
2410089E03Rik	T	C	15: 8,187,548	V750A	probably benign	Het
Acadsb	T	C	7: 131,434,315	Y285H	possibly damaging	Het
Adam17	A	G	12: 21,345,668	S285P	probably benign	Het
Adcy10	A	G	1: 165,556,916	N1082S	probably benign	Het
Ahdc1	T	A	4: 133,062,345	L299Q	possibly damaging	Het
Ambra1	T	A	2: 91,772,600		probably benign	Het
Arfgef1	T	C	1: 10,153,678	Q1465R	probably damaging	Het
Arfgef1	G	T	1: 10,153,679	Q1465K	probably damaging	Het
Atp8a1	A	G	5: 67,738,462	V543A	probably damaging	Het
BC034090	T	A	1: 155,241,439	D311V	probably damaging	Het
Blnk	G	T	19: 40,962,377	P110Q	probably damaging	Het
Cc2d2a	A	G	5: 43,718,585	E968G	probably damaging	Het
Ccdc14	A	T	16: 34,709,533	E394V	probably damaging	Het
Ccdc162	A	T	10: 41,615,958	H1086Q	probably benign	Het
Ccdc85b	T	A	19: 5,457,220	I60F	probably damaging	Het
Ceacam20	T	A	7: 19,989,977	L562Q	probably damaging	Het
Cntrl	T	C	2: 35,118,137	F188L	probably benign	Het
Dclk1	A	T	3: 55,466,601		probably benign	Het
Ddx20	A	T	3: 105,680,358	L434H	probably damaging	Het
Ddx51	G	A	5: 110,656,862	V547M	probably damaging	Het
Dnah11	T	A	12: 118,108,944	Q1472L	probably benign	Het
Dnajb13	T	C	7: 100,507,422	E149G	probably damaging	Het
Fat4	A	G	3: 38,981,775	N3192S	probably damaging	Het
Fat4	A	T	3: 38,995,971	D3994V	probably damaging	Het
Fcgr1	C	A	3: 96,284,620		probably null	Het
Gm11639	A	G	11: 104,776,356	E1422G	probably benign	Het
Gm12185	G	A	11: 48,907,912	R585*	probably null	Het
Gm32687	A	G	10: 81,879,470	H232R	probably benign	Het
Gm5431	G	T	11: 48,888,490	A535D	probably damaging	Het
Gm8300	G	T	12: 87,516,618		probably benign	Het
Gm906	A	T	13: 50,246,971	Y440N	possibly damaging	Het
Jarid2	C	T	13: 44,902,985	P556S	probably damaging	Het
Map3k4	C	A	17: 12,248,916	G1077V	probably damaging	Het
Mast4	C	T	13: 102,804,647	V301I	probably damaging	Het
Mlxip	A	G	5: 123,445,672	T433A	possibly damaging	Het
Mus81	G	T	19: 5,485,526	H199Q	probably benign	Het
Mylk3	G	A	8: 85,359,263	T54M	probably damaging	Het
Nalcn	A	G	14: 123,314,094	F1034L	possibly damaging	Het
Ninj2	A	G	6: 120,198,131	I88V	possibly damaging	Het
Nomo1	C	T	7: 46,045,967	P277L	probably damaging	Het
Nup214	C	T	2: 32,051,798	S571L	probably damaging	Het
Olfr1469	T	A	19: 13,411,428	N286K	probably damaging	Het
Olfr461	T	C	6: 40,544,656	S108G	probably benign	Het
Olfr980	T	A	9: 40,006,713	M79L	probably benign	Het
Pcdh15	C	T	10: 74,502,687	P1005S	probably damaging	Het
Pkhd1l1	G	A	15: 44,511,674	A942T	possibly damaging	Het
Plagl1	T	C	10: 13,125,116	C34R	probably damaging	Het
Plekha2	T	C	8: 25,059,264	Q168R	probably benign	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plekhm3	T	G	1: 64,892,753	K564T	possibly damaging	Het
Plpp2	A	G	10: 79,530,546	V26A	possibly damaging	Het
Prdm10	T	G	9: 31,329,823	Y302*	probably null	Het
Prdm8	A	G	5: 98,184,612	E124G	probably damaging	Het
Prg4	T	G	1: 150,455,906		probably benign	Het
Qser1	A	G	2: 104,788,130	V779A	probably benign	Het
Rbm39	G	A	2: 156,167,584	R123C	probably damaging	Het
Ric1	C	T	19: 29,587,772	P640S	probably damaging	Het
Rpl14	G	A	9: 120,574,227		probably benign	Het
Rsl1d1	T	A	16: 11,193,694	D382V	probably benign	Het
Rubcn	G	T	16: 32,868,144		probably benign	Het
Sec16a	G	A	2: 26,430,486	R1361C	probably damaging	Het
Slc26a11	T	G	11: 119,356,972	V41G	probably damaging	Het
Slc41a2	A	G	10: 83,316,096	F172L	possibly damaging	Het
Slc4a4	A	C	5: 89,179,831	Y674S	probably damaging	Het
Strc	A	C	2: 121,378,014	M292R	probably benign	Het
Syde2	A	G	3: 145,988,626	T210A	probably benign	Het
Tcf7l2	C	A	19: 55,755,048	A97E	probably benign	Het
Tenm3	C	T	8: 48,236,439	D2038N	probably damaging	Het
Tepsin	G	A	11: 120,095,364	T168M	probably damaging	Het
Tex15	A	T	8: 33,557,428	M178L	probably benign	Het
Tgfbr2	T	C	9: 116,110,051	N236S	probably damaging	Het
Tnrc18	A	G	5: 142,727,989	V2531A	probably damaging	Het
Ttn	T	G	2: 76,895,423		probably benign	Het
Tubgcp3	G	T	8: 12,637,000	D630E	probably damaging	Het
Ubr4	G	A	4: 139,406,528	W745*	probably null	Het
Vmn2r115	G	A	17: 23,346,015	G292D	probably benign	Het
Vmn2r38	T	A	7: 9,075,341	K681*	probably null	Het
Xrcc6	A	G	15: 82,031,174	K98E	probably benign	Het
Zfp423	A	G	8: 87,803,779	V13A	probably benign	Het
Zfp512b	A	G	2: 181,586,348	I5T	possibly damaging	Het
Zmynd8	C	T	2: 165,875,750	E14K	probably damaging	Het

Other mutations in Nfatc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Nfatc1	APN	18	80667026	missense	probably damaging	1.00
IGL00742:Nfatc1	APN	18	80698014	missense	probably benign	0.20
IGL01510:Nfatc1	APN	18	80698188	missense	probably damaging	1.00
IGL01790:Nfatc1	APN	18	80667042	missense	probably damaging	1.00
IGL02548:Nfatc1	APN	18	80697898	missense	probably damaging	1.00
goldfeld	UTSW	18	80697832	missense	probably damaging	0.99
Instrumenten	UTSW	18	80682191	missense	probably damaging	0.98
Original	UTSW	18	80653564	splice site	probably null
BB003:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
BB013:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
R0019:Nfatc1	UTSW	18	80635504	missense	probably benign
R0411:Nfatc1	UTSW	18	80698042	missense	possibly damaging	0.88
R0738:Nfatc1	UTSW	18	80697910	missense	probably damaging	1.00
R0940:Nfatc1	UTSW	18	80635895	missense	probably benign	0.03
R1458:Nfatc1	UTSW	18	80665267	splice site	probably benign
R1622:Nfatc1	UTSW	18	80666967	missense	probably damaging	1.00
R1845:Nfatc1	UTSW	18	80635531	missense	possibly damaging	0.67
R2110:Nfatc1	UTSW	18	80635664	nonsense	probably null
R2112:Nfatc1	UTSW	18	80635664	nonsense	probably null
R2157:Nfatc1	UTSW	18	80635845	missense	possibly damaging	0.88
R3857:Nfatc1	UTSW	18	80665275	splice site	probably benign
R3859:Nfatc1	UTSW	18	80665275	splice site	probably benign
R4108:Nfatc1	UTSW	18	80698368	missense	possibly damaging	0.68
R4510:Nfatc1	UTSW	18	80635579	missense	probably damaging	0.96
R4511:Nfatc1	UTSW	18	80635579	missense	probably damaging	0.96
R4618:Nfatc1	UTSW	18	80697832	missense	probably damaging	0.99
R4850:Nfatc1	UTSW	18	80697865	missense	probably benign	0.30
R5329:Nfatc1	UTSW	18	80708117	start codon destroyed	probably null
R5395:Nfatc1	UTSW	18	80636020	missense	possibly damaging	0.80
R5468:Nfatc1	UTSW	18	80649855	missense	probably benign	0.00
R5522:Nfatc1	UTSW	18	80653529	missense	probably benign	0.36
R5568:Nfatc1	UTSW	18	80649822	missense	probably benign	0.12
R6111:Nfatc1	UTSW	18	80697910	missense	probably damaging	1.00
R6190:Nfatc1	UTSW	18	80712670	missense	probably benign	0.21
R6397:Nfatc1	UTSW	18	80635941	missense	probably damaging	1.00
R6943:Nfatc1	UTSW	18	80635555	missense	probably damaging	1.00
R6994:Nfatc1	UTSW	18	80653564	splice site	probably null
R7679:Nfatc1	UTSW	18	80607990	missense	probably benign
R7703:Nfatc1	UTSW	18	80682289	missense	probably damaging	1.00
R7926:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
R8346:Nfatc1	UTSW	18	80682167	missense	probably benign	0.00
R8411:Nfatc1	UTSW	18	80667042	missense	probably damaging	1.00
R8480:Nfatc1	UTSW	18	80635644	missense	probably benign	0.15
R8669:Nfatc1	UTSW	18	80682191	missense	probably damaging	0.98
R8928:Nfatc1	UTSW	18	80697965	missense	possibly damaging	0.82
R9194:Nfatc1	UTSW	18	80708043	missense	probably benign	0.04
R9281:Nfatc1	UTSW	18	80697975	missense	probably damaging	1.00
X0062:Nfatc1	UTSW	18	80697618	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- TGGTGCCATAACACACAGC -3'
(R):5'- TGGTGCCTACTTACTGCGAG -3'

Sequencing Primer
(F):5'- CCAGAAAGAGGCAAATCTGTCATCG -3'
(R):5'- GGTGCCTACTTACTGCGAGTCTTC -3'

Posted On

2018-11-28