Incidental Mutation 'R6970:Nfatc1'
ID542221
Institutional Source Beutler Lab
Gene Symbol Nfatc1
Ensembl Gene ENSMUSG00000033016
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
SynonymsNFATc, NFAT2, 2210017P03Rik, NF-ATc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6970 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location80606205-80713071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 80667013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 513 (S513A)
Ref Sequence ENSEMBL: ENSMUSP00000129001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035800] [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]
Predicted Effect probably benign
Transcript: ENSMUST00000035800
AA Change: S499A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046312
Gene: ENSMUSG00000033016
AA Change: S499A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 7.4e-28 PFAM
IPT 582 681 8.99e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078049
AA Change: S513A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016
AA Change: S513A

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD 429 589 1.3e-27 PFAM
IPT 596 695 8.99e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167977
AA Change: S499A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: S499A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 4.9e-28 PFAM
IPT 582 681 8.99e-21 SMART
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170905
AA Change: S513A

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: S513A

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD_DNA_bind 429 589 5.1e-28 PFAM
IPT 596 695 8.99e-21 SMART
low complexity region 846 855 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Nfatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Nfatc1 APN 18 80667026 missense probably damaging 1.00
IGL00742:Nfatc1 APN 18 80698014 missense probably benign 0.20
IGL01510:Nfatc1 APN 18 80698188 missense probably damaging 1.00
IGL01790:Nfatc1 APN 18 80667042 missense probably damaging 1.00
IGL02548:Nfatc1 APN 18 80697898 missense probably damaging 1.00
goldfeld UTSW 18 80697832 missense probably damaging 0.99
Original UTSW 18 80653564 splice site probably null
BB003:Nfatc1 UTSW 18 80697666 missense probably damaging 0.96
BB013:Nfatc1 UTSW 18 80697666 missense probably damaging 0.96
R0019:Nfatc1 UTSW 18 80635504 missense probably benign
R0411:Nfatc1 UTSW 18 80698042 missense possibly damaging 0.88
R0738:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R0940:Nfatc1 UTSW 18 80635895 missense probably benign 0.03
R1458:Nfatc1 UTSW 18 80665267 splice site probably benign
R1622:Nfatc1 UTSW 18 80666967 missense probably damaging 1.00
R1845:Nfatc1 UTSW 18 80635531 missense possibly damaging 0.67
R2110:Nfatc1 UTSW 18 80635664 nonsense probably null
R2112:Nfatc1 UTSW 18 80635664 nonsense probably null
R2157:Nfatc1 UTSW 18 80635845 missense possibly damaging 0.88
R3857:Nfatc1 UTSW 18 80665275 splice site probably benign
R3859:Nfatc1 UTSW 18 80665275 splice site probably benign
R4108:Nfatc1 UTSW 18 80698368 missense possibly damaging 0.68
R4510:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4511:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4618:Nfatc1 UTSW 18 80697832 missense probably damaging 0.99
R4850:Nfatc1 UTSW 18 80697865 missense probably benign 0.30
R5329:Nfatc1 UTSW 18 80708117 start codon destroyed probably null
R5395:Nfatc1 UTSW 18 80636020 missense possibly damaging 0.80
R5468:Nfatc1 UTSW 18 80649855 missense probably benign 0.00
R5522:Nfatc1 UTSW 18 80653529 missense probably benign 0.36
R5568:Nfatc1 UTSW 18 80649822 missense probably benign 0.12
R6111:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R6190:Nfatc1 UTSW 18 80712670 missense probably benign 0.21
R6397:Nfatc1 UTSW 18 80635941 missense probably damaging 1.00
R6943:Nfatc1 UTSW 18 80635555 missense probably damaging 1.00
R6994:Nfatc1 UTSW 18 80653564 splice site probably null
R7679:Nfatc1 UTSW 18 80607990 missense probably benign
R7703:Nfatc1 UTSW 18 80682289 missense probably damaging 1.00
R7926:Nfatc1 UTSW 18 80697666 missense probably damaging 0.96
R8346:Nfatc1 UTSW 18 80682167 missense probably benign 0.00
R8411:Nfatc1 UTSW 18 80667042 missense probably damaging 1.00
R8480:Nfatc1 UTSW 18 80635644 missense probably benign 0.15
X0062:Nfatc1 UTSW 18 80697618 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGGTGCCATAACACACAGC -3'
(R):5'- TGGTGCCTACTTACTGCGAG -3'

Sequencing Primer
(F):5'- CCAGAAAGAGGCAAATCTGTCATCG -3'
(R):5'- GGTGCCTACTTACTGCGAGTCTTC -3'
Posted On2018-11-28