Incidental Mutation 'R6970:Mus81'
ID542223
Institutional Source Beutler Lab
Gene Symbol Mus81
Ensembl Gene ENSMUSG00000024906
Gene NameMUS81 structure-specific endonuclease subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R6970 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5482345-5488402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5485526 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 199 (H199Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025841] [ENSMUST00000070118] [ENSMUST00000116560] [ENSMUST00000124334] [ENSMUST00000126471] [ENSMUST00000165485] [ENSMUST00000166253] [ENSMUST00000167371] [ENSMUST00000168330] [ENSMUST00000209469]
Predicted Effect probably benign
Transcript: ENSMUST00000025841
AA Change: H235Q

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025841
Gene: ENSMUSG00000024906
AA Change: H235Q

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 7e-3 SMART
PDB:2KP7|A 11 90 5e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 1e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070118
SMART Domains Protein: ENSMUSP00000064719
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
EGF_like 73 113 2.74e-1 SMART
low complexity region 115 130 N/A INTRINSIC
EGF_CA 142 182 1.08e-10 SMART
EGF_CA 183 221 1.94e-12 SMART
EGF_CA 222 261 1.36e-7 SMART
EGF_CA 262 301 2.19e-11 SMART
EGF 305 347 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116560
SMART Domains Protein: ENSMUSP00000112259
Gene: ENSMUSG00000056201

DomainStartEndE-ValueType
ADF 19 154 5.3e-56 SMART
low complexity region 195 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124334
AA Change: H235Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114895
Gene: ENSMUSG00000024906
AA Change: H235Q

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 9e-3 SMART
PDB:2KP7|A 11 90 9e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 3e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126471
SMART Domains Protein: ENSMUSP00000121435
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 11 72 8e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133436
AA Change: H199Q

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906
AA Change: H199Q

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164204
SMART Domains Protein: ENSMUSP00000128414
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Pfam:EGF_CA 37 69 5.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164388
SMART Domains Protein: ENSMUSP00000131979
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
EGF 4 35 1.59e1 SMART
EGF 39 81 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165485
SMART Domains Protein: ENSMUSP00000133016
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 163 1.08e-10 SMART
EGF_CA 164 202 1.94e-12 SMART
EGF_CA 203 242 1.36e-7 SMART
EGF_CA 243 282 2.19e-11 SMART
EGF 286 328 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166253
SMART Domains Protein: ENSMUSP00000127312
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 54 92 1.94e-12 SMART
EGF_CA 93 132 1.36e-7 SMART
EGF_CA 133 172 2.19e-11 SMART
EGF 176 218 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167371
SMART Domains Protein: ENSMUSP00000129746
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 161 1.94e-12 SMART
EGF_CA 162 201 1.36e-7 SMART
EGF_CA 202 241 2.19e-11 SMART
EGF 245 287 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168330
Predicted Effect probably benign
Transcript: ENSMUST00000209469
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous and heterozygous null mice for one allele display increased tumor incidence and reduced life spans. Homozygous null mice for a second allele display normal life span and tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr1469 T A 19: 13,411,428 N286K probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Mus81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Mus81 APN 19 5485633 unclassified probably benign
IGL03140:Mus81 APN 19 5483956 missense probably damaging 1.00
IGL03370:Mus81 APN 19 5484963 unclassified probably benign
city UTSW 19 5487793 missense probably benign 0.30
country UTSW 19 5484211 missense probably damaging 1.00
R0116:Mus81 UTSW 19 5486524 missense probably damaging 1.00
R0480:Mus81 UTSW 19 5487931 unclassified probably benign
R1243:Mus81 UTSW 19 5485117 missense probably benign
R1439:Mus81 UTSW 19 5485117 missense probably benign
R1477:Mus81 UTSW 19 5486334 missense probably benign 0.00
R1795:Mus81 UTSW 19 5483476 missense probably benign 0.00
R2346:Mus81 UTSW 19 5484963 unclassified probably benign
R2863:Mus81 UTSW 19 5486500 missense probably damaging 1.00
R3785:Mus81 UTSW 19 5485361 unclassified probably benign
R5312:Mus81 UTSW 19 5483494 missense possibly damaging 0.79
R5489:Mus81 UTSW 19 5487889 unclassified probably benign
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R7037:Mus81 UTSW 19 5486080 missense probably damaging 1.00
R7060:Mus81 UTSW 19 5487793 missense probably benign 0.30
R7100:Mus81 UTSW 19 5484211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCTCCAGTGGTCTCTGC -3'
(R):5'- CCACTGAACTTCTATCCAGGC -3'

Sequencing Primer
(F):5'- CCTCGGTGGTGCCACTATAATG -3'
(R):5'- GAACTTCTATCCAGGCTCACC -3'
Posted On2018-11-28