Incidental Mutation 'R6970:Olfr1469'
ID 542225
Institutional Source Beutler Lab
Gene Symbol Olfr1469
Ensembl Gene ENSMUSG00000063777
Gene Name olfactory receptor 1469
Synonyms GA_x6K02T2RE5P-3743369-3744289, MOR202-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R6970 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 13407849-13414540 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13411428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 286 (N286K)
Ref Sequence ENSEMBL: ENSMUSP00000150006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077538] [ENSMUST00000216910]
AlphaFold Q8VFW5
Predicted Effect probably damaging
Transcript: ENSMUST00000077538
AA Change: N286K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076741
Gene: ENSMUSG00000063777
AA Change: N286K

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-47 PFAM
Pfam:7tm_1 42 290 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216910
AA Change: N286K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,314 probably null Het
2410089E03Rik T C 15: 8,187,548 V750A probably benign Het
Acadsb T C 7: 131,434,315 Y285H possibly damaging Het
Adam17 A G 12: 21,345,668 S285P probably benign Het
Adcy10 A G 1: 165,556,916 N1082S probably benign Het
Ahdc1 T A 4: 133,062,345 L299Q possibly damaging Het
Ambra1 T A 2: 91,772,600 probably benign Het
Arfgef1 T C 1: 10,153,678 Q1465R probably damaging Het
Arfgef1 G T 1: 10,153,679 Q1465K probably damaging Het
Atp8a1 A G 5: 67,738,462 V543A probably damaging Het
BC034090 T A 1: 155,241,439 D311V probably damaging Het
Blnk G T 19: 40,962,377 P110Q probably damaging Het
Cc2d2a A G 5: 43,718,585 E968G probably damaging Het
Ccdc14 A T 16: 34,709,533 E394V probably damaging Het
Ccdc162 A T 10: 41,615,958 H1086Q probably benign Het
Ccdc85b T A 19: 5,457,220 I60F probably damaging Het
Ceacam20 T A 7: 19,989,977 L562Q probably damaging Het
Cntrl T C 2: 35,118,137 F188L probably benign Het
Dclk1 A T 3: 55,466,601 probably benign Het
Ddx20 A T 3: 105,680,358 L434H probably damaging Het
Ddx51 G A 5: 110,656,862 V547M probably damaging Het
Dnah11 T A 12: 118,108,944 Q1472L probably benign Het
Dnajb13 T C 7: 100,507,422 E149G probably damaging Het
Fat4 A G 3: 38,981,775 N3192S probably damaging Het
Fat4 A T 3: 38,995,971 D3994V probably damaging Het
Fcgr1 C A 3: 96,284,620 probably null Het
Gm11639 A G 11: 104,776,356 E1422G probably benign Het
Gm12185 G A 11: 48,907,912 R585* probably null Het
Gm32687 A G 10: 81,879,470 H232R probably benign Het
Gm5431 G T 11: 48,888,490 A535D probably damaging Het
Gm8300 G T 12: 87,516,618 probably benign Het
Gm906 A T 13: 50,246,971 Y440N possibly damaging Het
Jarid2 C T 13: 44,902,985 P556S probably damaging Het
Map3k4 C A 17: 12,248,916 G1077V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlxip A G 5: 123,445,672 T433A possibly damaging Het
Mus81 G T 19: 5,485,526 H199Q probably benign Het
Mylk3 G A 8: 85,359,263 T54M probably damaging Het
Nalcn A G 14: 123,314,094 F1034L possibly damaging Het
Nfatc1 A C 18: 80,667,013 S513A probably benign Het
Ninj2 A G 6: 120,198,131 I88V possibly damaging Het
Nomo1 C T 7: 46,045,967 P277L probably damaging Het
Nup214 C T 2: 32,051,798 S571L probably damaging Het
Olfr461 T C 6: 40,544,656 S108G probably benign Het
Olfr980 T A 9: 40,006,713 M79L probably benign Het
Pcdh15 C T 10: 74,502,687 P1005S probably damaging Het
Pkhd1l1 G A 15: 44,511,674 A942T possibly damaging Het
Plagl1 T C 10: 13,125,116 C34R probably damaging Het
Plekha2 T C 8: 25,059,264 Q168R probably benign Het
Plekha6 G A 1: 133,263,818 A146T probably benign Het
Plekhm3 T G 1: 64,892,753 K564T possibly damaging Het
Plpp2 A G 10: 79,530,546 V26A possibly damaging Het
Prdm10 T G 9: 31,329,823 Y302* probably null Het
Prdm8 A G 5: 98,184,612 E124G probably damaging Het
Prg4 T G 1: 150,455,906 probably benign Het
Qser1 A G 2: 104,788,130 V779A probably benign Het
Rbm39 G A 2: 156,167,584 R123C probably damaging Het
Ric1 C T 19: 29,587,772 P640S probably damaging Het
Rpl14 G A 9: 120,574,227 probably benign Het
Rsl1d1 T A 16: 11,193,694 D382V probably benign Het
Rubcn G T 16: 32,868,144 probably benign Het
Sec16a G A 2: 26,430,486 R1361C probably damaging Het
Slc26a11 T G 11: 119,356,972 V41G probably damaging Het
Slc41a2 A G 10: 83,316,096 F172L possibly damaging Het
Slc4a4 A C 5: 89,179,831 Y674S probably damaging Het
Strc A C 2: 121,378,014 M292R probably benign Het
Syde2 A G 3: 145,988,626 T210A probably benign Het
Tcf7l2 C A 19: 55,755,048 A97E probably benign Het
Tenm3 C T 8: 48,236,439 D2038N probably damaging Het
Tepsin G A 11: 120,095,364 T168M probably damaging Het
Tex15 A T 8: 33,557,428 M178L probably benign Het
Tgfbr2 T C 9: 116,110,051 N236S probably damaging Het
Tnrc18 A G 5: 142,727,989 V2531A probably damaging Het
Ttn T G 2: 76,895,423 probably benign Het
Tubgcp3 G T 8: 12,637,000 D630E probably damaging Het
Ubr4 G A 4: 139,406,528 W745* probably null Het
Vmn2r115 G A 17: 23,346,015 G292D probably benign Het
Vmn2r38 T A 7: 9,075,341 K681* probably null Het
Xrcc6 A G 15: 82,031,174 K98E probably benign Het
Zfp423 A G 8: 87,803,779 V13A probably benign Het
Zfp512b A G 2: 181,586,348 I5T possibly damaging Het
Zmynd8 C T 2: 165,875,750 E14K probably damaging Het
Other mutations in Olfr1469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr1469 APN 19 13411226 missense probably benign 0.01
IGL01520:Olfr1469 APN 19 13410750 missense probably damaging 0.97
IGL01671:Olfr1469 APN 19 13410891 missense probably benign 0.29
IGL02247:Olfr1469 APN 19 13411467 missense probably benign 0.01
IGL02297:Olfr1469 APN 19 13411475 missense probably benign 0.00
IGL02417:Olfr1469 APN 19 13410895 missense possibly damaging 0.52
IGL02442:Olfr1469 APN 19 13410987 missense probably benign 0.00
IGL02989:Olfr1469 APN 19 13411486 missense probably benign
IGL03269:Olfr1469 APN 19 13411428 missense probably damaging 0.99
IGL02988:Olfr1469 UTSW 19 13411462 missense possibly damaging 0.75
R0707:Olfr1469 UTSW 19 13411420 missense probably benign 0.22
R1055:Olfr1469 UTSW 19 13411390 missense probably benign 0.10
R1102:Olfr1469 UTSW 19 13411090 missense probably damaging 1.00
R1946:Olfr1469 UTSW 19 13410779 missense possibly damaging 0.64
R2111:Olfr1469 UTSW 19 13410943 missense probably damaging 0.99
R4072:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4073:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4076:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4726:Olfr1469 UTSW 19 13411105 missense probably damaging 1.00
R4939:Olfr1469 UTSW 19 13410855 missense probably benign 0.10
R5914:Olfr1469 UTSW 19 13410962 missense probably benign 0.31
R6003:Olfr1469 UTSW 19 13411039 missense probably benign 0.34
R6743:Olfr1469 UTSW 19 13410593 missense probably damaging 1.00
R6825:Olfr1469 UTSW 19 13411150 missense probably benign 0.01
R6826:Olfr1469 UTSW 19 13411088 missense probably benign 0.05
R7558:Olfr1469 UTSW 19 13410991 missense probably damaging 1.00
R7596:Olfr1469 UTSW 19 13411147 missense probably benign 0.01
R7923:Olfr1469 UTSW 19 13410818 missense probably benign 0.17
R8014:Olfr1469 UTSW 19 13410811 missense not run
R8506:Olfr1469 UTSW 19 13411240 missense possibly damaging 0.49
R8746:Olfr1469 UTSW 19 13410728 missense probably benign 0.44
R8803:Olfr1469 UTSW 19 13410673 missense probably damaging 0.99
R9112:Olfr1469 UTSW 19 13411111 missense probably benign 0.05
Z1177:Olfr1469 UTSW 19 13410719 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAAGTTCTGGATATCGAAAGGC -3'
(R):5'- AAAGCAACTCATAAGTATGGTCCAG -3'

Sequencing Primer
(F):5'- CGAAAGGCTATATCCACTTGTGC -3'
(R):5'- CTCATAAGTATGGTCCAGAATTCAC -3'
Posted On 2018-11-28