Incidental Mutation 'R6971:Igfbpl1'
ID542239
Institutional Source Beutler Lab
Gene Symbol Igfbpl1
Ensembl Gene ENSMUSG00000035551
Gene Nameinsulin-like growth factor binding protein-like 1
SynonymsIGFBP-like protein, 2810453O06Rik, 2810011G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45809468-45826923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45816333 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000036974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044297]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044297
AA Change: V164A

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036974
Gene: ENSMUSG00000035551
AA Change: V164A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IB 28 100 1.31e-3 SMART
KAZAL 82 143 6.59e-14 SMART
IGc2 159 242 5.04e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Igfbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Igfbpl1 APN 4 45826478 missense probably damaging 0.99
IGL03339:Igfbpl1 APN 4 45813555 splice site probably benign
PIT1430001:Igfbpl1 UTSW 4 45826756 missense unknown
PIT4504001:Igfbpl1 UTSW 4 45813469 missense possibly damaging 0.86
R1824:Igfbpl1 UTSW 4 45826406 missense probably benign 0.19
R2655:Igfbpl1 UTSW 4 45816289 missense probably damaging 0.96
R3850:Igfbpl1 UTSW 4 45826426 missense probably benign 0.02
R5431:Igfbpl1 UTSW 4 45815588 missense probably benign 0.21
R5695:Igfbpl1 UTSW 4 45826374 missense probably damaging 1.00
R6229:Igfbpl1 UTSW 4 45813517 missense probably damaging 1.00
R6613:Igfbpl1 UTSW 4 45813447 missense probably benign 0.00
R6950:Igfbpl1 UTSW 4 45815494 missense probably damaging 1.00
R6954:Igfbpl1 UTSW 4 45826663 missense probably damaging 1.00
R7558:Igfbpl1 UTSW 4 45813497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACAGCGCTGGAGTATC -3'
(R):5'- CACTGACCACTGGAAATGGC -3'

Sequencing Primer
(F):5'- CAGCGCTGGAGTATCTTTGTTTAATC -3'
(R):5'- TCCATTATCATCAAGGTGGGAGC -3'
Posted On2018-11-28