Incidental Mutation 'R6971:Msl2'
ID542251
Institutional Source Beutler Lab
Gene Symbol Msl2
Ensembl Gene ENSMUSG00000066415
Gene NameMSL complex subunit 2
SynonymsMsl2l1, Rnf184
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location101074101-101104800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101100843 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 139 (F139L)
Ref Sequence ENSEMBL: ENSMUSP00000082270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941] [ENSMUST00000085177] [ENSMUST00000189616]
Predicted Effect probably benign
Transcript: ENSMUST00000066773
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075941
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085177
AA Change: F139L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082270
Gene: ENSMUSG00000066415
AA Change: F139L

DomainStartEndE-ValueType
Pfam:zf-RING_10 42 111 2.8e-36 PFAM
low complexity region 265 281 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
CXC 457 504 1.6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189616
SMART Domains Protein: ENSMUSP00000139396
Gene: ENSMUSG00000066415

DomainStartEndE-ValueType
PDB:4B86|L 1 47 2e-28 PDB
Meta Mutation Damage Score 0.0575 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Msl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Msl2 APN 9 101101070 missense probably benign 0.13
IGL02496:Msl2 APN 9 101100655 missense possibly damaging 0.93
IGL02798:Msl2 APN 9 101075377 missense probably benign 0.06
IGL03235:Msl2 APN 9 101100768 missense probably benign 0.03
anguished UTSW 9 101101975 missense possibly damaging 0.66
Appalled UTSW 9 101100843 missense probably benign
Crestfallen UTSW 9 101101091 nonsense probably null
R0497:Msl2 UTSW 9 101101294 missense probably benign 0.00
R1288:Msl2 UTSW 9 101102109 missense probably benign 0.01
R2015:Msl2 UTSW 9 101075251 start gained probably benign
R2038:Msl2 UTSW 9 101101984 missense probably damaging 1.00
R2238:Msl2 UTSW 9 101101370 missense probably benign 0.41
R4393:Msl2 UTSW 9 101101477 missense probably damaging 1.00
R4827:Msl2 UTSW 9 101102151 missense probably benign 0.00
R5290:Msl2 UTSW 9 101101407 unclassified probably null
R5567:Msl2 UTSW 9 101101737 missense possibly damaging 0.67
R5934:Msl2 UTSW 9 101101818 missense probably damaging 1.00
R5940:Msl2 UTSW 9 101101091 nonsense probably null
R6339:Msl2 UTSW 9 101101750 missense probably benign
R6736:Msl2 UTSW 9 101101002 missense probably damaging 0.99
R6950:Msl2 UTSW 9 101101975 missense possibly damaging 0.66
R7022:Msl2 UTSW 9 101075282 missense possibly damaging 0.91
R7408:Msl2 UTSW 9 101102117 missense probably benign 0.08
R7955:Msl2 UTSW 9 101102155 missense possibly damaging 0.69
R8069:Msl2 UTSW 9 101100960 missense probably benign
R8281:Msl2 UTSW 9 101101695 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACCTGCCAACACTATGTCTGC -3'
(R):5'- GTAGGCAAACCATTGATAACAGAAC -3'

Sequencing Primer
(F):5'- ACCTTCATGTAGCTGGTGCAAAG -3'
(R):5'- CATTGATAACAGAACTGCCAATGG -3'
Posted On2018-11-28