Incidental Mutation 'R6971:Shprh'
ID542254
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene NameSNF2 histone linker PHD RING helicase
Synonyms2610103K11Rik, D230017O13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location11149427-11217595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11166693 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 807 (I807F)
Ref Sequence ENSEMBL: ENSMUSP00000125457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: I807F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: I807F

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054814
AA Change: I807F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: I807F

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: I807F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: I807F

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159810
AA Change: I807F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: I807F

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160461
SMART Domains Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
PHD 131 178 2.33e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTGCTGCTTATTTCCCAGG -3'
(R):5'- GTCATACACACAGATATCCAAGTAGTC -3'

Sequencing Primer
(F):5'- GTGAAGAAACACGGCTTCTTAC -3'
(R):5'- GTAGTCCATACAAAACTATCATCCAG -3'
Posted On2018-11-28