Incidental Mutation 'R6971:Sec63'
ID542255
Institutional Source Beutler Lab
Gene Symbol Sec63
Ensembl Gene ENSMUSG00000019802
Gene NameSEC63-like (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6971 (G1)
Quality Score201.009
Status Validated
Chromosome10
Chromosomal Location42761496-42832514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42783442 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 42 (E42G)
Ref Sequence ENSEMBL: ENSMUSP00000019937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019937]
Predicted Effect probably damaging
Transcript: ENSMUST00000019937
AA Change: E42G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019937
Gene: ENSMUSG00000019802
AA Change: E42G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
DnaJ 103 157 6.14e-23 SMART
Blast:Sec63 170 208 9e-6 BLAST
Sec63 219 714 6.98e-10 SMART
low complexity region 734 760 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. The protein encoded by this gene and SEC62 protein are found to be associated with ribosome-free SEC61 complex. It is speculated that Sec61-Sec62-Sec63 may perform post-translational protein translocation into the ER. The Sec61-Sec62-Sec63 complex might also perform the backward transport of ER proteins that are subject to the ubiquitin-proteasome-dependent degradation pathway. The encoded protein is an integral membrane protein located in the rough ER. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Sec63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Sec63 APN 10 42812457 missense possibly damaging 0.56
IGL02111:Sec63 APN 10 42810888 missense probably damaging 1.00
IGL02457:Sec63 APN 10 42801733 splice site probably benign
IGL02613:Sec63 APN 10 42801707 missense probably damaging 1.00
IGL03002:Sec63 APN 10 42810909 missense possibly damaging 0.51
IGL03493:Sec63 APN 10 42828941 missense probably benign 0.06
cyst UTSW 10 42828865 intron probably null
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0233:Sec63 UTSW 10 42823908 missense possibly damaging 0.48
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0234:Sec63 UTSW 10 42798798 missense probably damaging 0.98
R0538:Sec63 UTSW 10 42798799 missense probably benign 0.01
R0734:Sec63 UTSW 10 42796208 missense probably benign 0.08
R0906:Sec63 UTSW 10 42801928 missense probably damaging 0.98
R1136:Sec63 UTSW 10 42806546 missense probably damaging 1.00
R1665:Sec63 UTSW 10 42798728 intron probably null
R1736:Sec63 UTSW 10 42827918 nonsense probably null
R1961:Sec63 UTSW 10 42823886 missense probably damaging 1.00
R2696:Sec63 UTSW 10 42783526 missense probably benign 0.05
R4886:Sec63 UTSW 10 42789393 nonsense probably null
R4908:Sec63 UTSW 10 42805190 missense probably damaging 0.99
R5174:Sec63 UTSW 10 42829081 utr 3 prime probably benign
R5619:Sec63 UTSW 10 42789382 missense probably damaging 1.00
R5766:Sec63 UTSW 10 42801681 missense probably damaging 0.99
R5820:Sec63 UTSW 10 42796245 missense possibly damaging 0.49
R6232:Sec63 UTSW 10 42828865 intron probably null
R6656:Sec63 UTSW 10 42816383 nonsense probably null
R6847:Sec63 UTSW 10 42791253 missense probably damaging 1.00
R8037:Sec63 UTSW 10 42783487 missense probably benign 0.00
RF010:Sec63 UTSW 10 42806624 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGTGAAATGCTCAGACAACTG -3'
(R):5'- TCTTTACAGCCACACATGTAAGC -3'

Sequencing Primer
(F):5'- AAGTTTCAGAGAAGTTTCACGTG -3'
(R):5'- ATGTAAGCCATCCTCCAATTCC -3'
Posted On2018-11-28