Incidental Mutation 'R6971:Mier2'
ID542256
Institutional Source Beutler Lab
Gene Symbol Mier2
Ensembl Gene ENSMUSG00000042570
Gene NameMIER family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79540245-79555199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79542429 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 385 (H385Y)
Ref Sequence ENSEMBL: ENSMUSP00000059864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062855] [ENSMUST00000165028] [ENSMUST00000172158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062855
AA Change: H385Y

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059864
Gene: ENSMUSG00000042570
AA Change: H385Y

DomainStartEndE-ValueType
ELM2 194 246 1.46e-9 SMART
SANT 295 344 6.01e-8 SMART
low complexity region 441 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165028
AA Change: H387Y

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127387
Gene: ENSMUSG00000042570
AA Change: H387Y

DomainStartEndE-ValueType
ELM2 196 248 1.46e-9 SMART
SANT 297 346 6.01e-8 SMART
low complexity region 443 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172158
SMART Domains Protein: ENSMUSP00000129732
Gene: ENSMUSG00000042570

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Mier2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Mier2 APN 10 79541180 makesense probably null
IGL01761:Mier2 APN 10 79548352 critical splice donor site probably null
IGL01845:Mier2 APN 10 79549584 missense possibly damaging 0.69
IGL02336:Mier2 APN 10 79548350 unclassified probably benign
IGL02882:Mier2 APN 10 79547721 missense probably damaging 1.00
IGL02902:Mier2 APN 10 79549622 missense probably damaging 1.00
R0325:Mier2 UTSW 10 79542596 critical splice donor site probably null
R0972:Mier2 UTSW 10 79544621 unclassified probably benign
R1326:Mier2 UTSW 10 79544709 missense probably damaging 1.00
R1333:Mier2 UTSW 10 79545157 missense probably benign 0.03
R1721:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1867:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R1868:Mier2 UTSW 10 79548830 missense probably damaging 1.00
R2015:Mier2 UTSW 10 79541202 splice site probably null
R2273:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R2274:Mier2 UTSW 10 79544534 missense probably damaging 1.00
R3729:Mier2 UTSW 10 79545042 unclassified probably benign
R3874:Mier2 UTSW 10 79541797 missense possibly damaging 0.49
R3881:Mier2 UTSW 10 79548750 unclassified probably null
R4755:Mier2 UTSW 10 79549197 missense probably damaging 1.00
R4758:Mier2 UTSW 10 79550348 missense probably damaging 1.00
R5070:Mier2 UTSW 10 79549577 missense probably benign 0.03
R6282:Mier2 UTSW 10 79544742 missense probably damaging 1.00
R6785:Mier2 UTSW 10 79544713 missense probably damaging 1.00
R6861:Mier2 UTSW 10 79541156 start gained probably benign
R6869:Mier2 UTSW 10 79542669 missense probably damaging 0.99
R6897:Mier2 UTSW 10 79544739 missense probably damaging 0.99
R6902:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6946:Mier2 UTSW 10 79540839 utr 3 prime probably benign
R6968:Mier2 UTSW 10 79540642 utr 3 prime probably benign
R7072:Mier2 UTSW 10 79540299 missense unknown
R7350:Mier2 UTSW 10 79540298 missense unknown
R7443:Mier2 UTSW 10 79540455 missense unknown
R7506:Mier2 UTSW 10 79550342 missense probably benign 0.14
R7545:Mier2 UTSW 10 79541194 missense possibly damaging 0.79
R7625:Mier2 UTSW 10 79542709 missense probably damaging 1.00
R7669:Mier2 UTSW 10 79549676 missense probably damaging 1.00
R7895:Mier2 UTSW 10 79541885 start gained probably benign
R7978:Mier2 UTSW 10 79541885 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCATGTCCCCTGTGTGAATG -3'
(R):5'- GACTACTTTGCCCAGCAGAC -3'

Sequencing Primer
(F):5'- ATGTCCCCTGTGTGAATGTACTTCTG -3'
(R):5'- AGGAAGTTTGTCTCCTCTGGAACC -3'
Posted On2018-11-28