Incidental Mutation 'R6971:Mdga2'
ID542265
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66550561 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 720 (Y720H)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000222623] [ENSMUST00000222987] [ENSMUST00000223141]
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: Y720H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: Y720H

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: Y710H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: Y651H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000222623
Predicted Effect probably benign
Transcript: ENSMUST00000222987
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: Y651H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGCTGAGAGGAAATAACTTCAAT -3'
(R):5'- TTACAAGCAGAATAGTTCCTTATGGA -3'

Sequencing Primer
(F):5'- ATTCTGAGTAGTATTGAAAAGC -3'
(R):5'- ATTCCTCTAAGCTGGGGCATCAAG -3'
Posted On2018-11-28