Incidental Mutation 'R6971:Setdb2'
ID542270
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene NameSET domain, bifurcated 2
SynonymsKMT1F, LOC239122
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location59402009-59440884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59415740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 371 (L371Q)
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: L387Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: L387Q

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161459
AA Change: L371Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: L371Q

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Nuggc T C 14: 65,608,856 V72A probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R1968:Setdb2 UTSW 14 59419409 missense probably damaging 1.00
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5656:Setdb2 UTSW 14 59419118 missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59402414 missense probably benign 0.12
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59423384 nonsense probably null
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCTTGGTACCTTATGGC -3'
(R):5'- GCTAGTCAACCCAGGCAATC -3'

Sequencing Primer
(F):5'- CATTACGGATGGTTGTAAGCCACC -3'
(R):5'- AGGCAATCTAACCTTACACTACTTTC -3'
Posted On2018-11-28