Mutagenetix > Incidental Mutation

Incidental Mutation 'R6971:Setdb2'

542270

Institutional Source

Beutler Lab

Gene Symbol

Setdb2

Ensembl Gene

ENSMUSG00000071350

Gene Name

SET domain, bifurcated 2

Synonyms

KMT1F, LOC239122

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R6971 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59402009-59440884 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59415740 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 371 (L371Q)

Ref Sequence

ENSEMBL: ENSMUSP00000124696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000161459]

AlphaFold

Q8C267

Predicted Effect

probably damaging
Transcript: ENSMUST00000095775
AA Change: L387Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: L387Q

Domain	Start	End	E-Value	Type
Pfam:MBD	164	236	3.4e-10	PFAM
Pfam:Pre-SET	250	362	1.7e-17	PFAM
SET	370	694	9.33e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161459
AA Change: L371Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: L371Q

Domain	Start	End	E-Value	Type
Pfam:MBD	148	220	2.7e-9	PFAM
Pfam:Pre-SET	233	346	1.3e-19	PFAM
SET	354	678	9.33e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	A	T	10: 87,165,041	T32S	possibly damaging	Het
2210408I21Rik	A	G	13: 77,193,187	S52G	possibly damaging	Het
Aadacl4	G	A	4: 144,622,733	V187M	probably damaging	Het
Adprhl1	T	A	8: 13,223,476	Q1094L	probably benign	Het
Amigo1	C	T	3: 108,188,136	S317L	probably benign	Het
Brca1	A	G	11: 101,534,005	F32L	probably benign	Het
C1qtnf7	T	A	5: 43,609,050		probably null	Het
Ccdc88c	A	T	12: 100,954,227	D378E	probably damaging	Het
Ccdc97	G	T	7: 25,714,959	Y123*	probably null	Het
Cdk10	T	A	8: 123,227,674	M46K	probably damaging	Het
Dsc3	A	G	18: 19,966,218		probably null	Het
Ephx3	T	A	17: 32,188,203	N254Y	possibly damaging	Het
Fnip2	G	A	3: 79,481,121	R768*	probably null	Het
Glra1	A	T	11: 55,536,499	Y3*	probably null	Het
Gltpd2	A	G	11: 70,520,464	T194A	probably damaging	Het
Hectd1	A	T	12: 51,748,743	L2301*	probably null	Het
Hmcn1	T	A	1: 150,993,051	M1L	probably benign	Het
Hmcn2	G	A	2: 31,432,321	E4133K	probably benign	Het
Hps3	A	T	3: 20,011,535	L714I	probably damaging	Het
Igfbpl1	A	G	4: 45,816,333	V164A	possibly damaging	Het
Ip6k2	T	C	9: 108,797,311		probably benign	Het
Itgb8	A	T	12: 119,190,631	Y224N	probably damaging	Het
Kcnt2	T	C	1: 140,512,908	L624S	probably benign	Het
Mdga2	A	G	12: 66,550,561	Y720H	probably damaging	Het
Mier2	G	A	10: 79,542,429	H385Y	possibly damaging	Het
Msl2	T	C	9: 101,100,843	F139L	probably benign	Het
Nuggc	T	C	14: 65,608,856	V72A	probably benign	Het
Olfr826	A	T	10: 130,180,769	V37E	possibly damaging	Het
Pde2a	T	A	7: 101,510,313	Y783*	probably null	Het
Pfkfb2	A	G	1: 130,700,796	Y358H	probably damaging	Het
Pou2f1	A	G	1: 165,931,689	S23P	probably damaging	Het
Prrc2a	T	C	17: 35,159,501		probably null	Het
Prss36	T	C	7: 127,945,238	T92A	probably benign	Het
Rnft2	A	G	5: 118,194,570		probably benign	Het
Sbno2	A	G	10: 80,060,034	V971A	possibly damaging	Het
Sec63	A	G	10: 42,783,442	E42G	probably damaging	Het
Shprh	A	T	10: 11,166,693	I807F	probably damaging	Het
Slc3a2	T	C	19: 8,709,610		probably null	Het
Srbd1	T	C	17: 86,099,290	I556V	possibly damaging	Het
Stim2	T	A	5: 54,118,299	C605*	probably null	Het
Tecrl	T	C	5: 83,354,802	T67A	possibly damaging	Het
Ttc33	C	A	15: 5,212,042	A116E	probably damaging	Het
Ttn	G	A	2: 76,942,049	T2503I	possibly damaging	Het
Ubp1	T	C	9: 113,972,763	I468T	probably damaging	Het
Urgcp	A	T	11: 5,718,115	H74Q	probably benign	Het
Vcan	A	G	13: 89,678,133	I2224T	probably damaging	Het
Vmn1r8	T	A	6: 57,036,415	N150K	probably damaging	Het
Vmn2r3	A	G	3: 64,259,247	M821T	probably damaging	Het
Zfp777	C	A	6: 48,024,691	A866S	probably damaging	Het

Other mutations in Setdb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Setdb2	APN	14	59415792	missense	probably damaging	1.00
IGL01695:Setdb2	APN	14	59402293	utr 3 prime	probably benign
IGL01720:Setdb2	APN	14	59423436	missense	possibly damaging	0.76
IGL02003:Setdb2	APN	14	59413490	missense	probably damaging	0.98
IGL02023:Setdb2	APN	14	59431158	missense	probably damaging	1.00
IGL02108:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02113:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02114:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02115:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02116:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02117:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02141:Setdb2	APN	14	59402315	missense	probably damaging	1.00
IGL02148:Setdb2	APN	14	59402315	missense	probably damaging	1.00
R0419:Setdb2	UTSW	14	59406744	splice site	probably null
R0610:Setdb2	UTSW	14	59417470	missense	possibly damaging	0.55
R0636:Setdb2	UTSW	14	59406704	missense	probably benign	0.40
R0890:Setdb2	UTSW	14	59419220	missense	possibly damaging	0.89
R0931:Setdb2	UTSW	14	59423496	splice site	probably benign
R1355:Setdb2	UTSW	14	59417441	missense	probably damaging	1.00
R1553:Setdb2	UTSW	14	59417485	missense	probably benign	0.04
R1968:Setdb2	UTSW	14	59419409	missense	probably damaging	1.00
R2472:Setdb2	UTSW	14	59419454	missense	possibly damaging	0.49
R2894:Setdb2	UTSW	14	59426467	missense	probably benign	0.00
R3919:Setdb2	UTSW	14	59419167	missense	probably damaging	1.00
R4609:Setdb2	UTSW	14	59415704	missense	probably damaging	1.00
R4629:Setdb2	UTSW	14	59409359	missense	probably benign	0.13
R4816:Setdb2	UTSW	14	59413646	missense	probably benign	0.05
R4864:Setdb2	UTSW	14	59409266	missense	probably benign	0.01
R4951:Setdb2	UTSW	14	59402303	missense	possibly damaging	0.72
R5040:Setdb2	UTSW	14	59415707	missense	probably damaging	0.99
R5245:Setdb2	UTSW	14	59426494	missense	probably null	0.00
R5358:Setdb2	UTSW	14	59409436	missense	probably benign	0.17
R5656:Setdb2	UTSW	14	59419118	missense	probably damaging	1.00
R5705:Setdb2	UTSW	14	59423365	missense	possibly damaging	0.80
R6103:Setdb2	UTSW	14	59409532	splice site	probably null
R6106:Setdb2	UTSW	14	59423449	nonsense	probably null
R6388:Setdb2	UTSW	14	59424697	missense	probably benign
R6431:Setdb2	UTSW	14	59419056	missense	probably damaging	1.00
R6494:Setdb2	UTSW	14	59402414	missense	probably benign	0.12
R7442:Setdb2	UTSW	14	59419251	missense	probably damaging	0.99
R7444:Setdb2	UTSW	14	59423345	nonsense	probably null
R7759:Setdb2	UTSW	14	59419364	missense	probably damaging	1.00
R8021:Setdb2	UTSW	14	59423384	nonsense	probably null
R8039:Setdb2	UTSW	14	59402375	missense	probably damaging	1.00
R8261:Setdb2	UTSW	14	59413692	splice site	probably benign
R8393:Setdb2	UTSW	14	59412731	missense	probably benign	0.04
R8513:Setdb2	UTSW	14	59402390	missense	probably damaging	1.00
R8700:Setdb2	UTSW	14	59417439	missense	probably damaging	1.00
R8707:Setdb2	UTSW	14	59423458	nonsense	probably null
R8940:Setdb2	UTSW	14	59409507	missense	probably damaging	1.00
R9217:Setdb2	UTSW	14	59409432	missense	possibly damaging	0.61
R9314:Setdb2	UTSW	14	59412791	missense	probably benign	0.02
R9336:Setdb2	UTSW	14	59423367	missense	unknown
R9442:Setdb2	UTSW	14	59402400	missense	probably damaging	1.00
R9525:Setdb2	UTSW	14	59409392	missense	probably benign	0.00
R9743:Setdb2	UTSW	14	59413553	missense	probably benign	0.00
X0017:Setdb2	UTSW	14	59419468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCGCTTGGTACCTTATGGC -3'
(R):5'- GCTAGTCAACCCAGGCAATC -3'

Sequencing Primer
(F):5'- CATTACGGATGGTTGTAAGCCACC -3'
(R):5'- AGGCAATCTAACCTTACACTACTTTC -3'

Posted On

2018-11-28