Incidental Mutation 'R6971:Nuggc'
ID542271
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Namenuclear GTPase, germinal center associated
SynonymsGm600, SLIP-GC, LOC239151
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6971 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location65598546-65648531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65608856 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000118402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
Predicted Effect probably benign
Transcript: ENSMUST00000079469
AA Change: V88A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: V88A

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150897
AA Change: V72A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: V72A

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A T 10: 87,165,041 T32S possibly damaging Het
2210408I21Rik A G 13: 77,193,187 S52G possibly damaging Het
Aadacl4 G A 4: 144,622,733 V187M probably damaging Het
Adprhl1 T A 8: 13,223,476 Q1094L probably benign Het
Amigo1 C T 3: 108,188,136 S317L probably benign Het
Brca1 A G 11: 101,534,005 F32L probably benign Het
C1qtnf7 T A 5: 43,609,050 probably null Het
Ccdc88c A T 12: 100,954,227 D378E probably damaging Het
Ccdc97 G T 7: 25,714,959 Y123* probably null Het
Cdk10 T A 8: 123,227,674 M46K probably damaging Het
Dsc3 A G 18: 19,966,218 probably null Het
Ephx3 T A 17: 32,188,203 N254Y possibly damaging Het
Fnip2 G A 3: 79,481,121 R768* probably null Het
Glra1 A T 11: 55,536,499 Y3* probably null Het
Gltpd2 A G 11: 70,520,464 T194A probably damaging Het
Hectd1 A T 12: 51,748,743 L2301* probably null Het
Hmcn1 T A 1: 150,993,051 M1L probably benign Het
Hmcn2 G A 2: 31,432,321 E4133K probably benign Het
Hps3 A T 3: 20,011,535 L714I probably damaging Het
Igfbpl1 A G 4: 45,816,333 V164A possibly damaging Het
Ip6k2 T C 9: 108,797,311 probably benign Het
Itgb8 A T 12: 119,190,631 Y224N probably damaging Het
Kcnt2 T C 1: 140,512,908 L624S probably benign Het
Mdga2 A G 12: 66,550,561 Y720H probably damaging Het
Mier2 G A 10: 79,542,429 H385Y possibly damaging Het
Msl2 T C 9: 101,100,843 F139L probably benign Het
Olfr826 A T 10: 130,180,769 V37E possibly damaging Het
Pde2a T A 7: 101,510,313 Y783* probably null Het
Pfkfb2 A G 1: 130,700,796 Y358H probably damaging Het
Pou2f1 A G 1: 165,931,689 S23P probably damaging Het
Prrc2a T C 17: 35,159,501 probably null Het
Prss36 T C 7: 127,945,238 T92A probably benign Het
Rnft2 A G 5: 118,194,570 probably benign Het
Sbno2 A G 10: 80,060,034 V971A possibly damaging Het
Sec63 A G 10: 42,783,442 E42G probably damaging Het
Setdb2 A T 14: 59,415,740 L371Q probably damaging Het
Shprh A T 10: 11,166,693 I807F probably damaging Het
Slc3a2 T C 19: 8,709,610 probably null Het
Srbd1 T C 17: 86,099,290 I556V possibly damaging Het
Stim2 T A 5: 54,118,299 C605* probably null Het
Tecrl T C 5: 83,354,802 T67A possibly damaging Het
Ttc33 C A 15: 5,212,042 A116E probably damaging Het
Ttn G A 2: 76,942,049 T2503I possibly damaging Het
Ubp1 T C 9: 113,972,763 I468T probably damaging Het
Urgcp A T 11: 5,718,115 H74Q probably benign Het
Vcan A G 13: 89,678,133 I2224T probably damaging Het
Vmn1r8 T A 6: 57,036,415 N150K probably damaging Het
Vmn2r3 A G 3: 64,259,247 M821T probably damaging Het
Zfp777 C A 6: 48,024,691 A866S probably damaging Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65624142 missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
R7954:Nuggc UTSW 14 65623251 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGTTCTGTGGTAAGCGGGC -3'
(R):5'- AAGAAAGCCTGCAGCCATAG -3'

Sequencing Primer
(F):5'- AGTGAGTGCCTAGCTCCAGTG -3'
(R):5'- GCCTGCAGCCATAGGGATTTTTC -3'
Posted On2018-11-28