Incidental Mutation 'R6972:B3gnt7'
ID542277
Institutional Source Beutler Lab
Gene Symbol B3gnt7
Ensembl Gene ENSMUSG00000079445
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7
Synonymsbeta-3GnT7, C330001H22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location86302832-86307305 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 86305387 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000140392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113306] [ENSMUST00000188695]
Predicted Effect probably benign
Transcript: ENSMUST00000113306
AA Change: M118I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108931
Gene: ENSMUSG00000079445
AA Change: M118I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Galactosyl_T 144 341 1.6e-50 PFAM
Pfam:Fringe 225 357 4.8e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188695
AA Change: M1I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140392
Gene: ENSMUSG00000079445
AA Change: M1I

DomainStartEndE-ValueType
Pfam:Galactosyl_T 27 155 1.8e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in B3gnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0399:B3gnt7 UTSW 1 86305711 nonsense probably null
R0414:B3gnt7 UTSW 1 86305629 missense probably damaging 0.98
R4754:B3gnt7 UTSW 1 86305557 missense probably benign 0.01
R4780:B3gnt7 UTSW 1 86305270 missense probably damaging 1.00
R5258:B3gnt7 UTSW 1 86305565 missense possibly damaging 0.85
R5338:B3gnt7 UTSW 1 86305644 missense probably damaging 1.00
R5815:B3gnt7 UTSW 1 86305788 missense probably benign 0.30
R6153:B3gnt7 UTSW 1 86305515 missense probably damaging 1.00
R6430:B3gnt7 UTSW 1 86306117 missense possibly damaging 0.80
R6919:B3gnt7 UTSW 1 86305694 missense probably damaging 1.00
R6973:B3gnt7 UTSW 1 86305387 start codon destroyed probably null 0.00
R7048:B3gnt7 UTSW 1 86305586 missense probably benign 0.04
R7107:B3gnt7 UTSW 1 86305773 missense probably damaging 1.00
R7125:B3gnt7 UTSW 1 86305377 missense probably damaging 1.00
R7598:B3gnt7 UTSW 1 86305778 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ACCCCAACAGCTTCTGGAAG -3'
(R):5'- TGATAGTGGGTTCGCTCCTC -3'

Sequencing Primer
(F):5'- CCAACAGCTTCTGGAAGAGTTC -3'
(R):5'- CTCTTGCTTGGAGGCCG -3'
Posted On2018-11-28