Incidental Mutation 'R6972:Kcnh1'
ID542278
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 1
SynonymsKv10.1, Eag1, ether a go-go
MMRRC Submission
Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location192190774-192510159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 192276836 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 233 (I233V)
Ref Sequence ENSEMBL: ENSMUSP00000106468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844]
Predicted Effect probably benign
Transcript: ENSMUST00000078470
AA Change: I233V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: I233V

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110844
AA Change: I233V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: I233V

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192418882 missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192337593 missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192505856 missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 192191015 missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192337543 nonsense probably null
IGL02447:Kcnh1 APN 1 192224916 missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192505381 missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 192221420 missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 192276915 missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 192276900 missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192434891 missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192434800 missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 192276999 missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192337687 nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192418684 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276804 nonsense probably null
R0226:Kcnh1 UTSW 1 192276805 missense probably damaging 1.00
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0422:Kcnh1 UTSW 1 192337580 missense probably benign
R0510:Kcnh1 UTSW 1 192418941 splice site probably benign
R0612:Kcnh1 UTSW 1 192277053 missense probably damaging 1.00
R0667:Kcnh1 UTSW 1 192506038 missense probably benign 0.00
R0838:Kcnh1 UTSW 1 192413206 missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 192276702 missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192505763 missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192413068 missense possibly damaging 0.64
R1997:Kcnh1 UTSW 1 192276935 missense probably damaging 0.99
R2254:Kcnh1 UTSW 1 192505414 splice site probably null
R2274:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R2275:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192506060 missense probably benign 0.00
R3427:Kcnh1 UTSW 1 192241930 missense probably benign 0.06
R3552:Kcnh1 UTSW 1 192238766 missense probably damaging 1.00
R3718:Kcnh1 UTSW 1 192238799 missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192506024 missense probably damaging 1.00
R4009:Kcnh1 UTSW 1 192277140 missense probably benign
R4027:Kcnh1 UTSW 1 192276699 missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192505517 missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 192276717 missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 192277080 missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192505475 missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192337747 missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192505528 missense probably benign 0.00
R5244:Kcnh1 UTSW 1 192224876 missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192505691 missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192413077 missense probably benign 0.01
R6182:Kcnh1 UTSW 1 192191053 missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192418781 missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 192277104 missense probably benign
R6655:Kcnh1 UTSW 1 192413083 missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192337641 missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192505289 makesense probably null
R7199:Kcnh1 UTSW 1 192337605 missense probably benign 0.01
R7219:Kcnh1 UTSW 1 192505637 missense probably benign
R7749:Kcnh1 UTSW 1 192277139 missense probably benign
R7799:Kcnh1 UTSW 1 192434875 missense probably damaging 0.96
R7862:Kcnh1 UTSW 1 192190859 start gained probably benign
R8068:Kcnh1 UTSW 1 192241942 missense probably benign 0.00
R8375:Kcnh1 UTSW 1 192434816 missense probably damaging 1.00
Z1176:Kcnh1 UTSW 1 192418737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGGTGAGATGCTCCTATG -3'
(R):5'- GGTCGATCACAAACCACGTC -3'

Sequencing Primer
(F):5'- CTGGTGAGATGCTCCTATGAAATCC -3'
(R):5'- CAAACCACGTCTTCAGGTAGTTCATG -3'
Posted On2018-11-28