Incidental Mutation 'R6972:Zeb2'
ID542279
Institutional Source Beutler Lab
Gene Symbol Zeb2
Ensembl Gene ENSMUSG00000026872
Gene Namezinc finger E-box binding homeobox 2
SynonymsZfhx1b, Zfx1b, SIP1, 9130203F04Rik, D130016B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location44983632-45117395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44997318 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 531 (K531E)
Ref Sequence ENSEMBL: ENSMUSP00000076111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028229] [ENSMUST00000068415] [ENSMUST00000076836] [ENSMUST00000176438] [ENSMUST00000176732] [ENSMUST00000177302] [ENSMUST00000200844] [ENSMUST00000201211] [ENSMUST00000201623] [ENSMUST00000201804]
Predicted Effect probably damaging
Transcript: ENSMUST00000028229
AA Change: K576E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028229
Gene: ENSMUSG00000026872
AA Change: K576E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068415
AA Change: K532E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069685
Gene: ENSMUSG00000026872
AA Change: K532E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076836
AA Change: K531E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076111
Gene: ENSMUSG00000026872
AA Change: K531E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 210 233 2.09e-3 SMART
ZnF_C2H2 240 262 9.88e-5 SMART
ZnF_C2H2 281 303 4.87e-4 SMART
ZnF_C2H2 309 329 1.86e1 SMART
low complexity region 351 363 N/A INTRINSIC
ZnF_C2H2 580 600 5.54e1 SMART
HOX 643 705 2.05e-3 SMART
low complexity region 777 807 N/A INTRINSIC
low complexity region 840 855 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
ZnF_C2H2 998 1020 4.47e-3 SMART
ZnF_C2H2 1026 1048 2.17e-1 SMART
ZnF_C2H2 1054 1075 1.89e-1 SMART
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1133 1149 N/A INTRINSIC
low complexity region 1157 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176438
AA Change: K532E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134849
Gene: ENSMUSG00000026872
AA Change: K532E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176732
SMART Domains Protein: ENSMUSP00000135393
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
ZnF_C2H2 60 83 2.09e-3 SMART
ZnF_C2H2 90 112 9.88e-5 SMART
ZnF_C2H2 131 153 4.87e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177302
AA Change: K532E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134747
Gene: ENSMUSG00000026872
AA Change: K532E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200844
AA Change: K508E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144421
Gene: ENSMUSG00000026872
AA Change: K508E

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
ZnF_C2H2 217 239 4.2e-7 SMART
ZnF_C2H2 258 280 2e-6 SMART
ZnF_C2H2 286 306 8e-2 SMART
low complexity region 328 340 N/A INTRINSIC
ZnF_C2H2 557 577 2.4e-1 SMART
HOX 620 682 1.1e-5 SMART
low complexity region 754 784 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
ZnF_C2H2 975 997 1.9e-5 SMART
ZnF_C2H2 1003 1025 9.6e-4 SMART
ZnF_C2H2 1031 1052 7.9e-4 SMART
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1110 1126 N/A INTRINSIC
low complexity region 1134 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201211
SMART Domains Protein: ENSMUSP00000144406
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201623
SMART Domains Protein: ENSMUSP00000144075
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201804
AA Change: K561E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144637
Gene: ENSMUSG00000026872
AA Change: K561E

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
ZnF_C2H2 240 263 9.2e-6 SMART
ZnF_C2H2 270 292 4.2e-7 SMART
ZnF_C2H2 311 333 2e-6 SMART
ZnF_C2H2 339 359 8e-2 SMART
low complexity region 381 393 N/A INTRINSIC
ZnF_C2H2 610 630 2.4e-1 SMART
HOX 673 731 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202432
Meta Mutation Damage Score 0.4374 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mutants exhibit a variety of defects at embryonic day 8.5 and die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Zeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Zeb2 APN 2 44997275 missense probably damaging 1.00
IGL01639:Zeb2 APN 2 44997257 missense probably benign
IGL02016:Zeb2 APN 2 44988874 missense possibly damaging 0.71
IGL02337:Zeb2 APN 2 44997230 missense probably damaging 0.96
IGL02745:Zeb2 APN 2 44994475 unclassified probably benign
IGL02893:Zeb2 APN 2 44996607 missense probably benign 0.03
IGL03412:Zeb2 APN 2 45002708 intron probably benign
Dropped UTSW 2 45110041 missense possibly damaging 0.66
Okapi UTSW 2 44997156 missense probably damaging 1.00
sable UTSW 2 44997318 missense probably damaging 1.00
R0514:Zeb2 UTSW 2 45002647 missense possibly damaging 0.52
R0603:Zeb2 UTSW 2 45017426 missense probably benign 0.45
R0608:Zeb2 UTSW 2 44996126 missense possibly damaging 0.87
R1236:Zeb2 UTSW 2 44994646 missense probably damaging 1.00
R1529:Zeb2 UTSW 2 44997194 missense probably damaging 1.00
R1581:Zeb2 UTSW 2 44997000 missense probably damaging 0.99
R1636:Zeb2 UTSW 2 45002611 missense probably damaging 1.00
R1924:Zeb2 UTSW 2 45002612 missense probably damaging 1.00
R2012:Zeb2 UTSW 2 44997950 missense probably damaging 1.00
R2097:Zeb2 UTSW 2 44997156 missense probably damaging 1.00
R2156:Zeb2 UTSW 2 44988809 missense probably benign 0.20
R4385:Zeb2 UTSW 2 45023062 missense probably damaging 1.00
R4472:Zeb2 UTSW 2 45023011 missense probably damaging 1.00
R4678:Zeb2 UTSW 2 44996341 missense probably damaging 0.99
R4769:Zeb2 UTSW 2 44996435 missense probably damaging 1.00
R4816:Zeb2 UTSW 2 44997768 missense probably damaging 0.99
R4918:Zeb2 UTSW 2 44996882 missense probably damaging 1.00
R4969:Zeb2 UTSW 2 44998919 missense probably damaging 1.00
R5191:Zeb2 UTSW 2 45002600 missense probably benign 0.00
R5195:Zeb2 UTSW 2 45001635 missense probably damaging 1.00
R5322:Zeb2 UTSW 2 44997095 missense probably damaging 1.00
R5699:Zeb2 UTSW 2 44997788 missense probably damaging 1.00
R5750:Zeb2 UTSW 2 44997518 missense probably damaging 0.96
R5764:Zeb2 UTSW 2 44996919 missense possibly damaging 0.89
R5914:Zeb2 UTSW 2 44997052 missense probably benign 0.00
R5918:Zeb2 UTSW 2 45111259 intron probably benign
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6302:Zeb2 UTSW 2 44997759 missense probably benign 0.18
R6372:Zeb2 UTSW 2 45002539 missense probably damaging 1.00
R6402:Zeb2 UTSW 2 44996975 missense probably damaging 1.00
R6492:Zeb2 UTSW 2 45110496 intron probably benign
R6554:Zeb2 UTSW 2 44997512 missense probably damaging 1.00
R6675:Zeb2 UTSW 2 44997445 nonsense probably null
R6735:Zeb2 UTSW 2 45110016 missense probably null 0.99
R6870:Zeb2 UTSW 2 44988910 missense probably damaging 0.98
R6925:Zeb2 UTSW 2 44994529 missense probably damaging 1.00
R6963:Zeb2 UTSW 2 44988799 missense probably damaging 0.97
R7144:Zeb2 UTSW 2 45110041 missense possibly damaging 0.66
R7178:Zeb2 UTSW 2 44996994 missense probably damaging 0.97
R7379:Zeb2 UTSW 2 45001817 splice site probably null
R7419:Zeb2 UTSW 2 44996347 missense probably benign 0.20
R7580:Zeb2 UTSW 2 44994532 missense probably damaging 1.00
R7599:Zeb2 UTSW 2 44994613 missense probably damaging 1.00
R7625:Zeb2 UTSW 2 45002572 missense probably damaging 1.00
R7917:Zeb2 UTSW 2 44996409 missense possibly damaging 0.50
R8132:Zeb2 UTSW 2 44989130 missense probably damaging 1.00
R8412:Zeb2 UTSW 2 44998952 missense probably damaging 1.00
R8413:Zeb2 UTSW 2 44996171 missense probably damaging 0.99
R8417:Zeb2 UTSW 2 45022996 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTATCGTTCATGCTGATGC -3'
(R):5'- TACGGTTTCTAGGCAAAAGATGG -3'

Sequencing Primer
(F):5'- CCCGGGAAGCTTTCTTTACAGAAC -3'
(R):5'- TTTCTAGGCAAAAGATGGACTGC -3'
Posted On2018-11-28