Incidental Mutation 'R6972:Calcrl'
ID542281
Institutional Source Beutler Lab
Gene Symbol Calcrl
Ensembl Gene ENSMUSG00000059588
Gene Namecalcitonin receptor-like
SynonymsCRLR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location84330626-84425411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 84368578 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 156 (I156L)
Ref Sequence ENSEMBL: ENSMUSP00000097527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074262] [ENSMUST00000099944]
Predicted Effect probably benign
Transcript: ENSMUST00000074262
AA Change: I156L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073875
Gene: ENSMUSG00000059588
AA Change: I156L

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 5.7e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099944
AA Change: I156L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097527
Gene: ENSMUSG00000059588
AA Change: I156L

DomainStartEndE-ValueType
HormR 60 135 1.4e-26 SMART
Pfam:7tm_2 137 379 3.2e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in lethality between E13.5-E14.5, hydrops fetalis and cardiovascular defects such as thin vascular smooth muscle walls and small, disorganized hearts resulting from a decrease in cell proliferation and an increasein apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Calcrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Calcrl APN 2 84370454 missense probably benign 0.05
IGL01395:Calcrl APN 2 84368575 missense probably benign 0.25
IGL01672:Calcrl APN 2 84345070 missense probably damaging 1.00
IGL01738:Calcrl APN 2 84370449 missense probably benign 0.00
IGL01773:Calcrl APN 2 84370443 missense probably benign
IGL02007:Calcrl APN 2 84375324 missense probably benign
IGL02254:Calcrl APN 2 84348208 missense probably damaging 1.00
IGL02887:Calcrl APN 2 84339242 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0008:Calcrl UTSW 2 84373274 missense probably benign 0.04
R0485:Calcrl UTSW 2 84370091 missense probably benign 0.01
R1579:Calcrl UTSW 2 84333537 missense probably benign 0.00
R1640:Calcrl UTSW 2 84333677 missense probably damaging 0.98
R1694:Calcrl UTSW 2 84339287 missense probably damaging 1.00
R1731:Calcrl UTSW 2 84345168 critical splice donor site probably null
R1779:Calcrl UTSW 2 84351285 missense probably damaging 1.00
R1992:Calcrl UTSW 2 84370511 missense probably damaging 0.98
R2262:Calcrl UTSW 2 84345173 missense probably damaging 1.00
R2763:Calcrl UTSW 2 84370503 missense probably damaging 0.99
R3903:Calcrl UTSW 2 84368642 splice site probably benign
R4838:Calcrl UTSW 2 84351205 missense probably damaging 0.99
R4901:Calcrl UTSW 2 84333513 missense probably benign 0.00
R4997:Calcrl UTSW 2 84351248 nonsense probably null
R4998:Calcrl UTSW 2 84339314 missense probably damaging 1.00
R5791:Calcrl UTSW 2 84351265 missense probably damaging 1.00
R5887:Calcrl UTSW 2 84370497 missense probably damaging 1.00
R6046:Calcrl UTSW 2 84375314 missense probably benign 0.00
R6207:Calcrl UTSW 2 84333530 missense probably benign 0.00
R6959:Calcrl UTSW 2 84370084 missense possibly damaging 0.76
R7522:Calcrl UTSW 2 84373364 missense probably benign
R7653:Calcrl UTSW 2 84345185 nonsense probably null
R7911:Calcrl UTSW 2 84351231 missense probably damaging 1.00
R8082:Calcrl UTSW 2 84370442 missense possibly damaging 0.56
R8110:Calcrl UTSW 2 84339339 missense probably damaging 1.00
R8152:Calcrl UTSW 2 84339249 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCACCCTGCCTATTTCATGAAAC -3'
(R):5'- TGTCTCTGAGCCTCAAATTTGTG -3'

Sequencing Primer
(F):5'- TCCTCACATGAGCTCAC -3'
(R):5'- AGCAAGTGTTTGTAAATCTCTCTCC -3'
Posted On2018-11-28