Incidental Mutation 'R6972:Prg2'
ID542282
Institutional Source Beutler Lab
Gene Symbol Prg2
Ensembl Gene ENSMUSG00000027073
Gene Nameproteoglycan 2, bone marrow
SynonymsmMBP, mMBP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6972 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location84980461-84983632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84982273 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 109 (R109H)
Ref Sequence ENSEMBL: ENSMUSP00000028467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028467]
Predicted Effect probably benign
Transcript: ENSMUST00000028467
AA Change: R109H

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028467
Gene: ENSMUSG00000027073
AA Change: R109H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 43 76 N/A INTRINSIC
CLECT 90 222 1.99e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the predominant constituent of the crystalline core of the eosinophil granule. High levels of the proform of this protein are also present in placenta and pregnancy serum, where it exists as a complex with several other proteins including pregnancy-associated plasma protein A (PAPPA), angiotensinogen (AGT), and C3dg. This protein may be involved in antiparasitic defense mechanisms as a cytotoxin and helminthotoxin, and in immune hypersensitivity reactions. The encoded protein contains a peptide that displays potent antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria, and fungi. It is directly implicated in epithelial cell damage, exfoliation, and bronchospasm in allergic diseases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype although fine structure changes occur in eosinophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Lmcd1 C T 6: 112,310,698 T115I probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Prg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02714:Prg2 APN 2 84983505 missense probably damaging 1.00
R0114:Prg2 UTSW 2 84983456 splice site probably benign
R0972:Prg2 UTSW 2 84982049 missense probably benign 0.00
R2029:Prg2 UTSW 2 84981998 splice site probably benign
R5000:Prg2 UTSW 2 84982023 missense probably benign 0.33
R6661:Prg2 UTSW 2 84983276 critical splice donor site probably null
R6919:Prg2 UTSW 2 84983256 missense probably damaging 1.00
R8078:Prg2 UTSW 2 84982260 missense probably benign 0.10
R8154:Prg2 UTSW 2 84983256 missense probably damaging 1.00
Z1088:Prg2 UTSW 2 84982265 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAGAACTTGCCTAGGGATGCAG -3'
(R):5'- GCTACAGCCATTAGAAGACAGC -3'

Sequencing Primer
(F):5'- CTTGCCTAGGGATGCAGAGATATC -3'
(R):5'- TACAGCCATTAGAAGACAGCAGAGC -3'
Posted On2018-11-28